EMAIL THIS PAGE TO A FRIEND

WFDC8

WAP four-disulfide core domain 8

Synonyms: C20orf170 WAP8 dJ461P17.1
UniProtKB ID: Q8IUA0, E1P623, Q5TDV2, Q96A34
Gene ID:
Human(90199) Summary: This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. The encoded protein contains a Kunitz-inhibitor domain, in addition to three WFDC domains. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Two alternatively spliced transcript variants have been found for this gene, and they encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(277343) WAP four-disulfide core domain 8
Rat(685170) WAP four-disulfide core domain 8
cow(521427) WAP four-disulfide core domain 8
sheep(101111824) WAP four-disulfide core domain 8
domestic guinea pig(100726000) WAP four-disulfide core domain 8
naked mole-rat(101705220) WAP four-disulfide core domain 8
chicken(419301) WAP four-disulfide core domain 8
domestic cat(101087653) WAP four-disulfide core domain 8
dog(477245) WAP four-disulfide core domain 8
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_204940 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_204940 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_204940 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_130896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130896 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130896 Rosetta Predictions human pricing
NM_181510 Rosetta Predictions human pricing
XM_001062667 Rosetta Predictions rat pricing
NM_001080550 Rosetta Predictions mouse pricing
XM_902928 Rosetta Predictions mouse pricing
XM_902929 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031039 predicted 262
2 SASI_Hs01_00031040 predicted 248
3 SASI_Hs01_00031041 predicted 537
4 SASI_Hs02_00362906 predicted 528
5 SASI_Hs01_00031043 predicted 333
6 SASI_Hs02_00362907 predicted 469
7 SASI_Hs01_00031044 predicted 500
8 SASI_Hs01_00031045 predicted 332
9 SASI_Hs01_00031046 predicted 559
10 SASI_Hs01_00031047 predicted 333
11 SASI_Hs01_00031042 predicted 470
12 SASI_Hs01_00031048 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046935 predicted 267
2 SASI_Hs01_00046936 predicted 255
3 SASI_Hs01_00046937 predicted 535
4 SASI_Hs02_00370135 predicted 535
5 SASI_Hs01_00046939 predicted 329
6 SASI_Hs02_00370136 predicted 465
7 SASI_Hs01_00046940 predicted 501
8 SASI_Hs01_00046941 predicted 327
9 SASI_Hs01_00046942 predicted 555
10 SASI_Hs01_00046943 predicted 333
11 SASI_Hs01_00046938 predicted 472
12 SASI_Hs01_00046944 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304174 predicted 241
2 SASI_Rn02_00304175 predicted 447
3 SASI_Rn02_00304176 predicted 405
4 SASI_Rn02_00304177 predicted 209
5 SASI_Rn02_00304178 predicted 373
6 SASI_Rn02_00304179 predicted 269
7 SASI_Rn02_00304180 predicted 361
8 SASI_Rn02_00304181 predicted 453
9 SASI_Rn02_00304182 predicted 297
10 SASI_Rn02_00304183 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293483 predicted 730
2 SASI_Mm02_00293484 predicted 888
3 SASI_Mm02_00293485 predicted 744
4 SASI_Mm02_00293486 predicted 1256
5 SASI_Mm02_00293487 predicted 671
6 SASI_Mm02_00293488 predicted 696
7 SASI_Mm02_00293489 predicted 1122
8 SASI_Mm02_00293490 predicted 1261
9 SASI_Mm02_00293491 predicted 750
10 SASI_Mm02_00293492 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272263 predicted 734
2 SASI_Mm01_00272264 predicted 474
3 SASI_Mm01_00272265 predicted 756
4 SASI_Mm01_00272266 predicted 478
5 SASI_Mm01_00272267 predicted 704
6 SASI_Mm01_00272268 predicted 476
7 SASI_Mm01_00272269 predicted 751
8 SASI_Mm01_00272270 predicted 425
9 SASI_Mm01_00272271 predicted 656
10 SASI_Mm01_00272272 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222926 predicted 1571
2 SASI_Mm01_00222927 predicted 1308
3 SASI_Mm01_00222928 predicted 1585
4 SASI_Mm01_00222929 predicted 1307
5 SASI_Mm01_00222930 predicted 1537
6 SASI_Mm01_00222931 predicted 1304
7 SASI_Mm01_00222932 predicted 1578
8 SASI_Mm01_00222933 predicted 1247
9 SASI_Mm01_00222934 predicted 1476
10 SASI_Mm01_00222935 predicted 1613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_204940
WFDC8 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-609s1c1
Sequence:CCGGGCCCATAGTGTGCTCTAAGATCTCGAGATCTTAGAGCACACTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-464s1c1
Sequence:CCGGTGTTCCCTTTCCAAATGCGAACTCGAGTTCGCATTTGGAAAGGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-351s1c1
Sequence:CCGGCCAGTGCAGAGCCTTTCTATACTCGAGTATAGAAAGGCTCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-500s1c1
Sequence:CCGGCCTGTAAGAACGACATGGATTCTCGAGAATCCATGTCGTTCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-219s1c1
Sequence:CCGGGCATTTCAAGTGCTGCCAATTCTCGAGAATTGGCAGCACTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_204940
WFDC8 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-609s1c1
Sequence:CCGGGCCCATAGTGTGCTCTAAGATCTCGAGATCTTAGAGCACACTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-464s1c1
Sequence:CCGGTGTTCCCTTTCCAAATGCGAACTCGAGTTCGCATTTGGAAAGGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-351s1c1
Sequence:CCGGCCAGTGCAGAGCCTTTCTATACTCGAGTATAGAAAGGCTCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-500s1c1
Sequence:CCGGCCTGTAAGAACGACATGGATTCTCGAGAATCCATGTCGTTCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-219s1c1
Sequence:CCGGGCATTTCAAGTGCTGCCAATTCTCGAGAATTGGCAGCACTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_204940
WFDC8 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-609s1c1
Sequence:CCGGGCCCATAGTGTGCTCTAAGATCTCGAGATCTTAGAGCACACTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-464s1c1
Sequence:CCGGTGTTCCCTTTCCAAATGCGAACTCGAGTTCGCATTTGGAAAGGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-351s1c1
Sequence:CCGGCCAGTGCAGAGCCTTTCTATACTCGAGTATAGAAAGGCTCTGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-500s1c1
Sequence:CCGGCCTGTAAGAACGACATGGATTCTCGAGAATCCATGTCGTTCTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_204940.4-219s1c1
Sequence:CCGGGCATTTCAAGTGCTGCCAATTCTCGAGAATTGGCAGCACTTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130896
WFDC8 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130896.1-880s1c1
Sequence:CCGGGTATCCAACTTGCCAAATTATCTCGAGATAATTTGGCAAGTTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-691s1c1
Sequence:CCGGGCCCTTGCTATGTACCAAGATCTCGAGATCTTGGTACATAGCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-607s1c1
Sequence:CCGGCCAGACAGACAAATGTTGTGACTCGAGTCACAACATTTGTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-765s1c1
Sequence:CCGGGCTCACATTGTGGACTGAAATCTCGAGATTTCAGTCCACAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-267s1c1
Sequence:CCGGCGGACTCATGTAACACAGATTCTCGAGAATCTGTGTTACATGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130896.2-503s21c1
Sequence:CCGGAGAACGGCCTGCATGTTAATTCTCGAGAATTAACATGCAGGCCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130896.2-841s21c1
Sequence:CCGGATTATGAGTAGCATGATAAAGCTCGAGCTTTATCATGCTACTCATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130896
WFDC8 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130896.1-880s1c1
Sequence:CCGGGTATCCAACTTGCCAAATTATCTCGAGATAATTTGGCAAGTTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-691s1c1
Sequence:CCGGGCCCTTGCTATGTACCAAGATCTCGAGATCTTGGTACATAGCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-607s1c1
Sequence:CCGGCCAGACAGACAAATGTTGTGACTCGAGTCACAACATTTGTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-765s1c1
Sequence:CCGGGCTCACATTGTGGACTGAAATCTCGAGATTTCAGTCCACAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-267s1c1
Sequence:CCGGCGGACTCATGTAACACAGATTCTCGAGAATCTGTGTTACATGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130896.2-503s21c1
Sequence:CCGGAGAACGGCCTGCATGTTAATTCTCGAGAATTAACATGCAGGCCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130896.2-841s21c1
Sequence:CCGGATTATGAGTAGCATGATAAAGCTCGAGCTTTATCATGCTACTCATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130896
WFDC8 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130896.1-880s1c1
Sequence:CCGGGTATCCAACTTGCCAAATTATCTCGAGATAATTTGGCAAGTTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-691s1c1
Sequence:CCGGGCCCTTGCTATGTACCAAGATCTCGAGATCTTGGTACATAGCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-607s1c1
Sequence:CCGGCCAGACAGACAAATGTTGTGACTCGAGTCACAACATTTGTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-765s1c1
Sequence:CCGGGCTCACATTGTGGACTGAAATCTCGAGATTTCAGTCCACAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130896.1-267s1c1
Sequence:CCGGCGGACTCATGTAACACAGATTCTCGAGAATCTGTGTTACATGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130896.2-503s21c1
Sequence:CCGGAGAACGGCCTGCATGTTAATTCTCGAGAATTAACATGCAGGCCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130896.2-841s21c1
Sequence:CCGGATTATGAGTAGCATGATAAAGCTCGAGCTTTATCATGCTACTCATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks