EMAIL THIS PAGE TO A FRIEND

WFDC9

WAP four-disulfide core domain 9

Synonyms: WAP9 dJ688G8.2
UniProtKB ID: Q8NEX5, Q3MIX6, Q5TGZ8
Gene ID:
Human(259240) Summary: The WAP-type four-disulfide core (WFDC) domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many members of the WFDC domain family. This gene encodes a protein which contains a WFDC domain, and is thus a member of the WFDC domain family. This gene and several other gene family members are clustered at 20q13.12. [provided by RefSeq, Jul 2008]
Mouse(629754) WAP four-disulfide core domain 9
Rat(408228) WAP four-disulfide core domain 9
domestic cat(101087146) WAP four-disulfide core domain 9
naked mole-rat(101704856) WAP four-disulfide core domain 9
domestic guinea pig(101788076) WAP four-disulfide core domain 9
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_147198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147198 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001160414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147198 Rosetta Predictions human pricing
NM_001008868 Rosetta Predictions rat pricing
XM_001477523 Rosetta Predictions mouse pricing
XM_894678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365540 predicted 302
2 SASI_Hs02_00365541 predicted 299
3 SASI_Hs01_00174896 predicted 335
4 SASI_Hs01_00174897 predicted 336
5 SASI_Hs01_00174898 predicted 222
6 SASI_Hs01_00174899 predicted 225
7 SASI_Hs01_00174900 predicted 219
8 SASI_Hs01_00174901 predicted 295
9 SASI_Hs01_00174902 predicted 429
10 SASI_Hs01_00174904 predicted 335
11 SASI_Hs01_00174903 predicted 349
12 SASI_Hs01_00174905 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080792 predicted 56
2 SASI_Rn01_00080794 predicted 69
3 SASI_Rn01_00080795 predicted 191
4 SASI_Rn01_00080796 predicted 38
5 SASI_Rn01_00080797 predicted 140
6 SASI_Rn01_00080798 predicted 182
7 SASI_Rn01_00080799 predicted 44
8 SASI_Rn01_00080800 predicted 18
9 SASI_Rn01_00080801 predicted 186
10 SASI_Rn02_00199394 predicted 42
11 SASI_Rn01_00080793 predicted 12
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00396447 predicted 311
2 SASI_Mm02_00396448 predicted 276
3 SASI_Mm02_00396449 predicted 294
4 SASI_Mm02_00396450 predicted 278
5 SASI_Mm02_00396451 predicted 272
6 SASI_Mm02_00396452 predicted 273
7 SASI_Mm02_00396453 predicted 259
8 SASI_Mm02_00396454 predicted 280
9 SASI_Mm02_00396455 predicted 262
10 SASI_Mm02_00396456 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252158 predicted 312
2 SASI_Mm01_00252159 predicted 277
3 SASI_Mm01_00252160 predicted 299
4 SASI_Mm01_00252161 predicted 306
5 SASI_Mm01_00252162 predicted 273
6 SASI_Mm01_00252163 predicted 269
7 SASI_Mm01_00252164 predicted 278
8 SASI_Mm01_00252165 predicted 309
9 SASI_Mm01_00252166 predicted 262
10 SASI_Mm01_00252167 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147198
WFDC9 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147198.2-440s21c1
Sequence:CCGGCATCTGCTTAGACAACGAAGACTCGAGTCTTCGTTGTCTAAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147198.2-463s21c1
Sequence:CCGGCCCTTAAATCAATGCTAAACCCTCGAGGGTTTAGCATTGATTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147198.2-248s21c1
Sequence:CCGGGTTCATCTCTGGAGTTGTGATCTCGAGATCACAACTCCAGAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147198.2-500s1c1
Sequence:CCGGCGATCACTACTGTGGGCTGAACTCGAGTTCAGCCCACAGTAGTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-354s1c1
Sequence:CCGGCCATATAAGTACTGTGAGAAACTCGAGTTTCTCACAGTACTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-394s1c1
Sequence:CCGGCTTGTGTACGTCCAAATCATACTCGAGTATGATTTGGACGTACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-290s1c1
Sequence:CCGGCTTCTGGAACAAAGATCCCTTCTCGAGAAGGGATCTTTGTTCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-410s1c1
Sequence:CCGGTCATACATGCTGCTGGACCTACTCGAGTAGGTCCAGCAGCATGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147198
WFDC9 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147198.2-440s21c1
Sequence:CCGGCATCTGCTTAGACAACGAAGACTCGAGTCTTCGTTGTCTAAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147198.2-463s21c1
Sequence:CCGGCCCTTAAATCAATGCTAAACCCTCGAGGGTTTAGCATTGATTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147198.2-248s21c1
Sequence:CCGGGTTCATCTCTGGAGTTGTGATCTCGAGATCACAACTCCAGAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147198.2-500s1c1
Sequence:CCGGCGATCACTACTGTGGGCTGAACTCGAGTTCAGCCCACAGTAGTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-354s1c1
Sequence:CCGGCCATATAAGTACTGTGAGAAACTCGAGTTTCTCACAGTACTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-394s1c1
Sequence:CCGGCTTGTGTACGTCCAAATCATACTCGAGTATGATTTGGACGTACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-290s1c1
Sequence:CCGGCTTCTGGAACAAAGATCCCTTCTCGAGAAGGGATCTTTGTTCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-410s1c1
Sequence:CCGGTCATACATGCTGCTGGACCTACTCGAGTAGGTCCAGCAGCATGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147198
WFDC9 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147198.2-440s21c1
Sequence:CCGGCATCTGCTTAGACAACGAAGACTCGAGTCTTCGTTGTCTAAGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147198.2-463s21c1
Sequence:CCGGCCCTTAAATCAATGCTAAACCCTCGAGGGTTTAGCATTGATTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147198.2-248s21c1
Sequence:CCGGGTTCATCTCTGGAGTTGTGATCTCGAGATCACAACTCCAGAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147198.2-500s1c1
Sequence:CCGGCGATCACTACTGTGGGCTGAACTCGAGTTCAGCCCACAGTAGTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-354s1c1
Sequence:CCGGCCATATAAGTACTGTGAGAAACTCGAGTTTCTCACAGTACTTATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-394s1c1
Sequence:CCGGCTTGTGTACGTCCAAATCATACTCGAGTATGATTTGGACGTACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-290s1c1
Sequence:CCGGCTTCTGGAACAAAGATCCCTTCTCGAGAAGGGATCTTTGTTCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147198.2-410s1c1
Sequence:CCGGTCATACATGCTGCTGGACCTACTCGAGTAGGTCCAGCAGCATGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160414
WFDC9 MISSION shRNA Bacterial Glycerol Stock
WAP four-disulfide core domain 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-362s21c1
Sequence:CCGGCACTGATGAAAGTCTAGTTTCCTCGAGGAAACTAGACTTTCATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-173s21c1
Sequence:CCGGTGGTGTTTCTGCACGTTCTCGCTCGAGCGAGAACGTGCAGAAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-220s21c1
Sequence:CCGGATTGACCAGTGTTGGGTACAGCTCGAGCTGTACCCAACACTGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-281s21c1
Sequence:CCGGGGAAGTGCGTGAGTCCAAATTCTCGAGAATTTGGACTCACGCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-326s21c1
Sequence:CCGGGAAACATCTGCTTGAACAATGCTCGAGCATTGTTCAAGCAGATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160414
WFDC9 MISSION shRNA shRNA Plasmid DNA
WAP four-disulfide core domain 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-362s21c1
Sequence:CCGGCACTGATGAAAGTCTAGTTTCCTCGAGGAAACTAGACTTTCATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-173s21c1
Sequence:CCGGTGGTGTTTCTGCACGTTCTCGCTCGAGCGAGAACGTGCAGAAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-220s21c1
Sequence:CCGGATTGACCAGTGTTGGGTACAGCTCGAGCTGTACCCAACACTGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-281s21c1
Sequence:CCGGGGAAGTGCGTGAGTCCAAATTCTCGAGAATTTGGACTCACGCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-326s21c1
Sequence:CCGGGAAACATCTGCTTGAACAATGCTCGAGCATTGTTCAAGCAGATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160414
WFDC9 MISSION shRNA Lentiviral Transduction Particles
WAP four-disulfide core domain 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-362s21c1
Sequence:CCGGCACTGATGAAAGTCTAGTTTCCTCGAGGAAACTAGACTTTCATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-173s21c1
Sequence:CCGGTGGTGTTTCTGCACGTTCTCGCTCGAGCGAGAACGTGCAGAAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-220s21c1
Sequence:CCGGATTGACCAGTGTTGGGTACAGCTCGAGCTGTACCCAACACTGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-281s21c1
Sequence:CCGGGGAAGTGCGTGAGTCCAAATTCTCGAGAATTTGGACTCACGCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160414.1-326s21c1
Sequence:CCGGGAAACATCTGCTTGAACAATGCTCGAGCATTGTTCAAGCAGATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks