EMAIL THIS PAGE TO A FRIEND

WFIKKN1

WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1

Synonyms: C16orf12 RJD2 WFDC20A WFIKKN
UniProtKB ID: Q96NZ8, Q7LDW0, Q8NBQ1, Q96S20
Gene ID:
Human(117166) Summary: This gene encodes a secreted multidomain protein consisting of a signal peptide, a WAP domain, a follistatin domain, an immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. These domains have been implicated frequently in inhibition of various types of proteases, suggesting that the encoded protein may be a multivalent protease inhibitor and may control the action of multiple types of serine proteases as well as metalloproteinases. [provided by RefSeq, Jul 2008]
Mouse(215001) WAP, FS, Ig, KU, and NTR-containing protein 1
Rat(363555) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
cow(540233) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
sheep(101102865) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
domestic guinea pig(100715551) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
naked mole-rat(101726657) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
Zebrafish(406570) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
Horse(100066872) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
domestic cat(101094072) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
dog(490094) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
chicken(429301) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053284 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU076361 MISSION® esiRNA esiRNA targeting mouse Wfikkn1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053284 Rosetta Predictions human pricing
XM_001060771 Rosetta Predictions rat pricing
XM_343870 Rosetta Predictions rat pricing
NM_001100454 Rosetta Predictions mouse pricing
XM_128578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026366 predicted 1366
2 SASI_Hs01_00026367 predicted 719
3 SASI_Hs01_00026368 predicted 430
4 SASI_Hs01_00026369 predicted 902
5 SASI_Hs01_00026370 predicted 1647
6 SASI_Hs01_00026371 predicted 899
7 SASI_Hs01_00026372 predicted 646
8 SASI_Hs01_00026373 predicted 414
9 SASI_Hs02_00361920 predicted 887
10 SASI_Hs02_00361921 predicted 1659
11 SASI_Hs01_00026364 predicted 939
12 SASI_Hs01_00026365 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297661 predicted 2079
2 SASI_Rn02_00297662 predicted 1269
3 SASI_Rn02_00297663 predicted 1256
4 SASI_Rn02_00297664 predicted 1335
5 SASI_Rn02_00297665 predicted 1844
6 SASI_Rn02_00297666 predicted 1276
7 SASI_Rn02_00297667 predicted 2143
8 SASI_Rn02_00297668 predicted 2240
9 SASI_Rn02_00297669 predicted 1898
10 SASI_Rn02_00297670 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396507 predicted 2077
2 SASI_Rn02_00396508 predicted 1270
3 SASI_Rn02_00396509 predicted 1257
4 SASI_Rn02_00396510 predicted 1333
5 SASI_Rn02_00396511 predicted 1847
6 SASI_Rn02_00396512 predicted 1277
7 SASI_Rn02_00396513 predicted 2140
8 SASI_Rn02_00396514 predicted 2241
9 SASI_Rn02_00396515 predicted 1894
10 SASI_Rn02_00396516 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302216 predicted 994
2 SASI_Mm02_00302217 predicted 1533
3 SASI_Mm02_00302218 predicted 1397
4 SASI_Mm02_00302219 predicted 1519
5 SASI_Mm02_00302220 predicted 2190
6 SASI_Mm02_00302221 predicted 2225
7 SASI_Mm02_00302222 predicted 1270
8 SASI_Mm02_00302223 predicted 2313
9 SASI_Mm02_00302224 predicted 1008
10 SASI_Mm02_00302225 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223042 predicted 998
2 SASI_Mm01_00223043 predicted 1542
3 SASI_Mm01_00223044 predicted 1401
4 SASI_Mm01_00223045 predicted 1523
5 SASI_Mm01_00223046 predicted 2001
6 SASI_Mm01_00223047 predicted 2203
7 SASI_Mm01_00223048 predicted 2238
8 SASI_Mm01_00223049 predicted 1278
9 SASI_Mm01_00223050 predicted 2317
10 SASI_Mm01_00223051 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128578
WFIKKN1 MISSION shRNA Bacterial Glycerol Stock
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-989s1c1
Sequence:CCGGGCCGACACACAAGCCTGTGTTCTCGAGAACACAGGCTTGTGTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-784s1c1
Sequence:CCGGCCCTGACCAAATGTATGGCAACTCGAGTTGCCATACATTTGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-500s1c1
Sequence:CCGGCGCTGCTACATGGACGCAGAACTCGAGTTCTGCGTCCATGTAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-1265s1c1
Sequence:CCGGGAAGGAAACAGCAATAACTTTCTCGAGAAAGTTATTGCTGTTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-1468s1c1
Sequence:CCGGTGATGTGCTAAAGGACGACAACTCGAGTTGTCGTCCTTTAGCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128578
WFIKKN1 MISSION shRNA shRNA Plasmid DNA
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-989s1c1
Sequence:CCGGGCCGACACACAAGCCTGTGTTCTCGAGAACACAGGCTTGTGTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-784s1c1
Sequence:CCGGCCCTGACCAAATGTATGGCAACTCGAGTTGCCATACATTTGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-500s1c1
Sequence:CCGGCGCTGCTACATGGACGCAGAACTCGAGTTCTGCGTCCATGTAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-1265s1c1
Sequence:CCGGGAAGGAAACAGCAATAACTTTCTCGAGAAAGTTATTGCTGTTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-1468s1c1
Sequence:CCGGTGATGTGCTAAAGGACGACAACTCGAGTTGTCGTCCTTTAGCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128578
WFIKKN1 MISSION shRNA Lentiviral Transduction Particles
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-989s1c1
Sequence:CCGGGCCGACACACAAGCCTGTGTTCTCGAGAACACAGGCTTGTGTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-784s1c1
Sequence:CCGGCCCTGACCAAATGTATGGCAACTCGAGTTGCCATACATTTGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-500s1c1
Sequence:CCGGCGCTGCTACATGGACGCAGAACTCGAGTTCTGCGTCCATGTAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-1265s1c1
Sequence:CCGGGAAGGAAACAGCAATAACTTTCTCGAGAAAGTTATTGCTGTTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128578.3-1468s1c1
Sequence:CCGGTGATGTGCTAAAGGACGACAACTCGAGTTGTCGTCCTTTAGCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053284
WFIKKN1 MISSION shRNA Bacterial Glycerol Stock
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-934s21c1
Sequence:CCGGTGCGCCCTGATCAGATGTATGCTCGAGCATACATCTGATCAGGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-1651s21c1
Sequence:CCGGTCAAGTTCTTGGGCACCAAGTCTCGAGACTTGGTGCCCAAGAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-1622s21c1
Sequence:CCGGGGACGTGCTCAAGGATGACAACTCGAGTTGTCATCCTTGAGCACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-648s21c1
Sequence:CCGGTACAACCGCTGCTATATGGACCTCGAGGTCCATATAGCAGCGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-433s21c1
Sequence:CCGGAGTGCTGCATCAACGTGTGTGCTCGAGCACACACGTTGATGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053284
WFIKKN1 MISSION shRNA shRNA Plasmid DNA
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-934s21c1
Sequence:CCGGTGCGCCCTGATCAGATGTATGCTCGAGCATACATCTGATCAGGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-1651s21c1
Sequence:CCGGTCAAGTTCTTGGGCACCAAGTCTCGAGACTTGGTGCCCAAGAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-1622s21c1
Sequence:CCGGGGACGTGCTCAAGGATGACAACTCGAGTTGTCATCCTTGAGCACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-648s21c1
Sequence:CCGGTACAACCGCTGCTATATGGACCTCGAGGTCCATATAGCAGCGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-433s21c1
Sequence:CCGGAGTGCTGCATCAACGTGTGTGCTCGAGCACACACGTTGATGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053284
WFIKKN1 MISSION shRNA Lentiviral Transduction Particles
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-934s21c1
Sequence:CCGGTGCGCCCTGATCAGATGTATGCTCGAGCATACATCTGATCAGGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-1651s21c1
Sequence:CCGGTCAAGTTCTTGGGCACCAAGTCTCGAGACTTGGTGCCCAAGAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-1622s21c1
Sequence:CCGGGGACGTGCTCAAGGATGACAACTCGAGTTGTCATCCTTGAGCACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-648s21c1
Sequence:CCGGTACAACCGCTGCTATATGGACCTCGAGGTCCATATAGCAGCGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053284.2-433s21c1
Sequence:CCGGAGTGCTGCATCAACGTGTGTGCTCGAGCACACACGTTGATGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks