EMAIL THIS PAGE TO A FRIEND

WFIKKN2

WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2

Synonyms: GASP-1 WFDC20B WFIKKNRP hGASP-1
UniProtKB ID: Q8TEU8, Q6UXZ9
Gene ID:
Human(124857) Summary: The WFIKKN1 protein contains a WAP domain, follistatin domain, immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. This gene encodes a WFIKKN1-related protein which has the same domain organization as the WFIKKN1 protein. The WAP-type, follistatin type, Kunitz-type, and NTR-type protease inhibitory domains may control the action of multiple types of proteases. [provided by RefSeq, Jul 2008]
Mouse(278507) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Rat(287631) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
chicken(422097) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Horse(100070101) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
domestic cat(101089222) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
dog(491086) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
naked mole-rat(101720024) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
domestic guinea pig(100713548) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
cow(531979) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
sheep(101104075) WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175575 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150681 MISSION® esiRNA esiRNA human WFIKKN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175575 Rosetta Predictions human pricing
XM_001081284 Rosetta Predictions rat pricing
XM_220855 Rosetta Predictions rat pricing
NM_181819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149065 predicted 2806
2 SASI_Hs01_00149066 predicted 2862
3 SASI_Hs01_00149067 predicted 1690
4 SASI_Hs01_00149068 predicted 1189
5 SASI_Hs01_00149069 predicted 1358
6 SASI_Hs01_00149070 predicted 1200
7 SASI_Hs01_00149071 predicted 1462
8 SASI_Hs02_00369003 predicted 2808
9 SASI_Hs01_00149073 predicted 2136
10 SASI_Hs02_00369004 predicted 1739
11 SASI_Hs01_00149072 predicted 2437
12 SASI_Hs01_00149074 predicted 2529
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371318 predicted 1348
2 SASI_Rn02_00371319 predicted 925
3 SASI_Rn02_00371320 predicted 661
4 SASI_Rn02_00371321 predicted 1718
5 SASI_Rn02_00371322 predicted 548
6 SASI_Rn02_00371323 predicted 1678
7 SASI_Rn02_00371324 predicted 328
8 SASI_Rn02_00371325 predicted 1897
9 SASI_Rn02_00371326 predicted 1736
10 SASI_Rn02_00371327 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379584 predicted 1620
2 SASI_Rn02_00379585 predicted 1199
3 SASI_Rn02_00379586 predicted 929
4 SASI_Rn02_00379587 predicted 1990
5 SASI_Rn02_00379588 predicted 826
6 SASI_Rn02_00379589 predicted 1948
7 SASI_Rn02_00379590 predicted 2173
8 SASI_Rn02_00379591 predicted 2016
9 SASI_Rn02_00379592 predicted 677
10 SASI_Rn02_00379593 predicted 1967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104229 predicted 1229
2 SASI_Mm01_00104230 predicted 1147
3 SASI_Mm01_00104231 predicted 749
4 SASI_Mm01_00104232 predicted 1032
5 SASI_Mm01_00104233 predicted 300
6 SASI_Mm01_00104234 predicted 470
7 SASI_Mm02_00349933 predicted 476
8 SASI_Mm01_00104235 predicted 496
9 SASI_Mm01_00104236 predicted 759
10 SASI_Mm01_00104238 predicted 1346
11 SASI_Mm01_00104237 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175575
WFIKKN2 MISSION shRNA Bacterial Glycerol Stock
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175575.5-2678s21c1
Sequence:CCGGCACCAGCTTGCTCAGATATTCCTCGAGGAATATCTGAGCAAGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175575.5-1195s21c1
Sequence:CCGGCATCACACTGGCCGTTGTAACCTCGAGGTTACAACGGCCAGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175575.5-1501s21c1
Sequence:CCGGTGCCCAGCTGGTCATCTATAACTCGAGTTATAGATGACCAGCTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-730s1c1
Sequence:CCGGGCCCGCTACATGGACGTGAAACTCGAGTTTCACGTCCATGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-1551s1c1
Sequence:CCGGCCTCAACCACTTTGAGACCTACTCGAGTAGGTCTCAAAGTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-1686s1c1
Sequence:CCGGCCAGTGCCAGTCCTTTGTCTACTCGAGTAGACAAAGGACTGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-1918s1c1
Sequence:CCGGGAGGTCCTAAAGGATGAGAAACTCGAGTTTCTCATCCTTTAGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175575.4-3107s1c1
Sequence:CCGGGCAGGAGAAATGAAGGAAGATCTCGAGATCTTCCTTCATTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175575
WFIKKN2 MISSION shRNA shRNA Plasmid DNA
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175575.5-2678s21c1
Sequence:CCGGCACCAGCTTGCTCAGATATTCCTCGAGGAATATCTGAGCAAGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175575.5-1195s21c1
Sequence:CCGGCATCACACTGGCCGTTGTAACCTCGAGGTTACAACGGCCAGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175575.5-1501s21c1
Sequence:CCGGTGCCCAGCTGGTCATCTATAACTCGAGTTATAGATGACCAGCTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-730s1c1
Sequence:CCGGGCCCGCTACATGGACGTGAAACTCGAGTTTCACGTCCATGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-1551s1c1
Sequence:CCGGCCTCAACCACTTTGAGACCTACTCGAGTAGGTCTCAAAGTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-1686s1c1
Sequence:CCGGCCAGTGCCAGTCCTTTGTCTACTCGAGTAGACAAAGGACTGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-1918s1c1
Sequence:CCGGGAGGTCCTAAAGGATGAGAAACTCGAGTTTCTCATCCTTTAGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175575.4-3107s1c1
Sequence:CCGGGCAGGAGAAATGAAGGAAGATCTCGAGATCTTCCTTCATTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175575
WFIKKN2 MISSION shRNA Lentiviral Transduction Particles
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175575.5-2678s21c1
Sequence:CCGGCACCAGCTTGCTCAGATATTCCTCGAGGAATATCTGAGCAAGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175575.5-1195s21c1
Sequence:CCGGCATCACACTGGCCGTTGTAACCTCGAGGTTACAACGGCCAGTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175575.5-1501s21c1
Sequence:CCGGTGCCCAGCTGGTCATCTATAACTCGAGTTATAGATGACCAGCTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-730s1c1
Sequence:CCGGGCCCGCTACATGGACGTGAAACTCGAGTTTCACGTCCATGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-1551s1c1
Sequence:CCGGCCTCAACCACTTTGAGACCTACTCGAGTAGGTCTCAAAGTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-1686s1c1
Sequence:CCGGCCAGTGCCAGTCCTTTGTCTACTCGAGTAGACAAAGGACTGGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175575.4-1918s1c1
Sequence:CCGGGAGGTCCTAAAGGATGAGAAACTCGAGTTTCTCATCCTTTAGGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175575.4-3107s1c1
Sequence:CCGGGCAGGAGAAATGAAGGAAGATCTCGAGATCTTCCTTCATTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181819
WFIKKN2 MISSION shRNA Bacterial Glycerol Stock
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-1212s1c1
Sequence:CCGGCCTATGCCAGTCCTTCGTCTACTCGAGTAGACGAAGGACTGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-373s1c1
Sequence:CCGGCCCGTGTGTAAGTGCAAAGATCTCGAGATCTTTGCACTTACACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-933s1c1
Sequence:CCGGCAGTCTCAATGGCACAGCTTTCTCGAGAAAGCTGTGCCATTGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-256s1c1
Sequence:CCGGGCCCGCTACATGGATGTGAAACTCGAGTTTCACATCCATGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-1433s1c1
Sequence:CCGGTGACCGTGGATGAGGTCTTAACTCGAGTTAAGACCTCATCCACGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181819
WFIKKN2 MISSION shRNA shRNA Plasmid DNA
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-1212s1c1
Sequence:CCGGCCTATGCCAGTCCTTCGTCTACTCGAGTAGACGAAGGACTGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-373s1c1
Sequence:CCGGCCCGTGTGTAAGTGCAAAGATCTCGAGATCTTTGCACTTACACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-933s1c1
Sequence:CCGGCAGTCTCAATGGCACAGCTTTCTCGAGAAAGCTGTGCCATTGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-256s1c1
Sequence:CCGGGCCCGCTACATGGATGTGAAACTCGAGTTTCACATCCATGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-1433s1c1
Sequence:CCGGTGACCGTGGATGAGGTCTTAACTCGAGTTAAGACCTCATCCACGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181819
WFIKKN2 MISSION shRNA Lentiviral Transduction Particles
WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-1212s1c1
Sequence:CCGGCCTATGCCAGTCCTTCGTCTACTCGAGTAGACGAAGGACTGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-373s1c1
Sequence:CCGGCCCGTGTGTAAGTGCAAAGATCTCGAGATCTTTGCACTTACACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-933s1c1
Sequence:CCGGCAGTCTCAATGGCACAGCTTTCTCGAGAAAGCTGTGCCATTGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-256s1c1
Sequence:CCGGGCCCGCTACATGGATGTGAAACTCGAGTTTCACATCCATGTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181819.1-1433s1c1
Sequence:CCGGTGACCGTGGATGAGGTCTTAACTCGAGTTAAGACCTCATCCACGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks