EMAIL THIS PAGE TO A FRIEND

WFS1

Wolfram syndrome 1 (wolframin)

Synonyms: WFRS WFS WFSL
UniProtKB ID: O76024, B2R797, D3DVT1, Q8N6I3, Q9UNW6
Gene ID:
Human(7466) Summary: This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(22393) Wolfram syndrome 1 homolog (human)
Rat(83725) Wolfram syndrome 1 (wolframin)
fruit fly(42679) wolfram syndrome 1
domestic cat(101092024) Wolfram syndrome 1 (wolframin)
dog(482113) Wolfram syndrome 1 (wolframin)
chicken(422857) Wolfram syndrome 1 (wolframin)
cow(100298456) Wolfram syndrome 1 (wolframin)
sheep(101112732) Wolfram syndrome 1 (wolframin)
domestic guinea pig(100731167) Wolfram syndrome 1 (wolframin)
naked mole-rat(101711151) Wolfram syndrome 1 (wolframin)
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006005 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006005 Rosetta Predictions human pricing
NM_031823 Rosetta Predictions rat pricing
NM_011716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135223 predicted 902
2 SASI_Hs01_00135224 predicted 365
3 SASI_Hs02_00340710 predicted 1053
4 SASI_Hs01_00135225 predicted 1727
5 SASI_Hs01_00135226 predicted 1465
6 SASI_Hs01_00135227 predicted 2317
7 SASI_Hs01_00135228 predicted 1342
8 SASI_Hs01_00135229 predicted 1703
9 SASI_Hs01_00135230 predicted 1020
10 SASI_Hs01_00135231 predicted 2137
11 SASI_Hs01_00135232 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045462 predicted 2327
2 SASI_Rn02_00265296 predicted 1540
3 SASI_Rn01_00045463 predicted 528
4 SASI_Rn01_00045464 predicted 235
5 SASI_Rn01_00045466 predicted 614
6 SASI_Rn01_00045467 predicted 732
7 SASI_Rn02_00265297 predicted 1131
8 SASI_Rn01_00045468 predicted 2336
9 SASI_Rn01_00045470 predicted 1995
10 SASI_Rn01_00045471 predicted 402
11 SASI_Rn01_00045465 predicted 566
12 SASI_Rn01_00045469 predicted 2176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193220 predicted 2428
2 SASI_Mm01_00193221 predicted 2430
3 SASI_Mm01_00193222 predicted 2342
4 SASI_Mm02_00321285 predicted 1135
5 SASI_Mm01_00193223 predicted 1644
6 SASI_Mm01_00193224 predicted 2386
7 SASI_Mm01_00193225 predicted 508
8 SASI_Mm01_00193227 predicted 1684
9 SASI_Mm01_00193228 predicted 2436
10 SASI_Mm01_00193229 predicted 666
11 SASI_Mm01_00193226 predicted 1002
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006005
VALIDATED
WFS1 MISSION shRNA Bacterial Glycerol Stock
Wolfram syndrome 1 (wolframin)
Human
24 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006005.2-2480s1c1
Sequence:CCGGCGACCGCTACAAGTTTGAGATCTCGAGATCTCAAACTTGTAGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006005.2-917s1c1
Sequence:CCGGGATCACTAAGAAGTACGCCAACTCGAGTTGGCGTACTTCTTAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006005.2-1184s1c1
Sequence:CCGGCGACTTCTTCGCCTTCTTCATCTCGAGATGAAGAAGGCGAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006005.2-515s1c1
Sequence:CCGGCGACACGGATGAAGAACTCAACTCGAGTTGAGTTCTTCATCCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.3-1948s21c1
Sequence:CCGGAGCTCACCAAGATCGCAGTCACTCGAGTGACTGCGATCTTGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-714s21c1
Sequence:CCGGGTCATGTACTGGAAGCTCAACCTCGAGGTTGAGCTTCCAGTACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.2-1065s21c1
Sequence:CCGGATCAAGGAGTACCTGATTGACCTCGAGGTCAATCAGGTACTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.2-960s21c1
Sequence:CCGGTTCCTGCAGGACGACGAAGATCTCGAGATCTTCGTCGTCCTGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1136s21c1
Sequence:CCGGCCACATCAACGCGCTCATCTTCTCGAGAAGATGAGCGCGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1722s21c1
Sequence:CCGGATGGCACAGCTGAGGAATTTCCTCGAGGAAATTCCTCAGCTGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-3185s21c1
Sequence:CCGGAGCACCCTGTTCCCTCTTTCTCTCGAGAGAAAGAGGGAACAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-3144s21c1
Sequence:CCGGAGCACTTTACAGATGAGATTCCTCGAGGAATCTCATCTGTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1596s21c1
Sequence:CCGGTTGAATTGGCCCTACCTGAAGCTCGAGCTTCAGGTAGGGCCAATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-892s21c1
Sequence:CCGGACATCGCGCTGGATGACTTTGCTCGAGCAAAGTCATCCAGCGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-408s21c1
Sequence:CCGGACAAAGGGAGACATGGAAATCCTCGAGGATTTCCATGTCTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1216s21c1
Sequence:CCGGTCTTCTACCTGTCCTTCATCTCTCGAGAGATGAAGGACAGGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1768s21c1
Sequence:CCGGCCTACCTGGTGTGCTTCATGTCTCGAGACATGAAGCACACCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-2131s21c1
Sequence:CCGGCAGAGGGCATGAAGGTCTACACTCGAGTGTAGACCTTCATGCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1373s21c1
Sequence:CCGGCCTGGAGCCCTATGCCCATTTCTCGAGAAATGGGCATAGGGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.3-1024s21c1
Sequence:CCGGGTCTGAAGGTGGTCAAGTACCCTCGAGGGTACTTGACCACCTTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1467s21c1
Sequence:CCGGGCTGTCATCACCGGCTTCTTTCTCGAGAAAGAAGCCGGTGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-2101s21c1
Sequence:CCGGTGCTGTTCTGCTGGTTCTATGCTCGAGCATAGAACCAGCAGAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1244s21c1
Sequence:CCGGGATCTGCACCCTCAAGGTGTTCTCGAGAACACCTTGAGGGTGCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1690s21c1
Sequence:CCGGTCTATGTCTACCTGCTCTATCCTCGAGGATAGAGCAGGTAGACATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006005
VALIDATED
WFS1 MISSION shRNA shRNA Plasmid DNA
Wolfram syndrome 1 (wolframin)
Human
24 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006005.2-2480s1c1
Sequence:CCGGCGACCGCTACAAGTTTGAGATCTCGAGATCTCAAACTTGTAGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006005.2-917s1c1
Sequence:CCGGGATCACTAAGAAGTACGCCAACTCGAGTTGGCGTACTTCTTAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006005.2-1184s1c1
Sequence:CCGGCGACTTCTTCGCCTTCTTCATCTCGAGATGAAGAAGGCGAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006005.2-515s1c1
Sequence:CCGGCGACACGGATGAAGAACTCAACTCGAGTTGAGTTCTTCATCCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.3-1948s21c1
Sequence:CCGGAGCTCACCAAGATCGCAGTCACTCGAGTGACTGCGATCTTGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-714s21c1
Sequence:CCGGGTCATGTACTGGAAGCTCAACCTCGAGGTTGAGCTTCCAGTACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.2-1065s21c1
Sequence:CCGGATCAAGGAGTACCTGATTGACCTCGAGGTCAATCAGGTACTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.2-960s21c1
Sequence:CCGGTTCCTGCAGGACGACGAAGATCTCGAGATCTTCGTCGTCCTGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1136s21c1
Sequence:CCGGCCACATCAACGCGCTCATCTTCTCGAGAAGATGAGCGCGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1722s21c1
Sequence:CCGGATGGCACAGCTGAGGAATTTCCTCGAGGAAATTCCTCAGCTGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-3185s21c1
Sequence:CCGGAGCACCCTGTTCCCTCTTTCTCTCGAGAGAAAGAGGGAACAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-3144s21c1
Sequence:CCGGAGCACTTTACAGATGAGATTCCTCGAGGAATCTCATCTGTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1596s21c1
Sequence:CCGGTTGAATTGGCCCTACCTGAAGCTCGAGCTTCAGGTAGGGCCAATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-892s21c1
Sequence:CCGGACATCGCGCTGGATGACTTTGCTCGAGCAAAGTCATCCAGCGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-408s21c1
Sequence:CCGGACAAAGGGAGACATGGAAATCCTCGAGGATTTCCATGTCTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1216s21c1
Sequence:CCGGTCTTCTACCTGTCCTTCATCTCTCGAGAGATGAAGGACAGGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1768s21c1
Sequence:CCGGCCTACCTGGTGTGCTTCATGTCTCGAGACATGAAGCACACCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-2131s21c1
Sequence:CCGGCAGAGGGCATGAAGGTCTACACTCGAGTGTAGACCTTCATGCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1373s21c1
Sequence:CCGGCCTGGAGCCCTATGCCCATTTCTCGAGAAATGGGCATAGGGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.3-1024s21c1
Sequence:CCGGGTCTGAAGGTGGTCAAGTACCCTCGAGGGTACTTGACCACCTTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1467s21c1
Sequence:CCGGGCTGTCATCACCGGCTTCTTTCTCGAGAAAGAAGCCGGTGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-2101s21c1
Sequence:CCGGTGCTGTTCTGCTGGTTCTATGCTCGAGCATAGAACCAGCAGAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1244s21c1
Sequence:CCGGGATCTGCACCCTCAAGGTGTTCTCGAGAACACCTTGAGGGTGCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1690s21c1
Sequence:CCGGTCTATGTCTACCTGCTCTATCCTCGAGGATAGAGCAGGTAGACATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006005
VALIDATED
WFS1 MISSION shRNA Lentiviral Transduction Particles
Wolfram syndrome 1 (wolframin)
Human
24 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006005.2-2480s1c1
Sequence:CCGGCGACCGCTACAAGTTTGAGATCTCGAGATCTCAAACTTGTAGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006005.2-917s1c1
Sequence:CCGGGATCACTAAGAAGTACGCCAACTCGAGTTGGCGTACTTCTTAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006005.2-1184s1c1
Sequence:CCGGCGACTTCTTCGCCTTCTTCATCTCGAGATGAAGAAGGCGAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006005.2-515s1c1
Sequence:CCGGCGACACGGATGAAGAACTCAACTCGAGTTGAGTTCTTCATCCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.3-1948s21c1
Sequence:CCGGAGCTCACCAAGATCGCAGTCACTCGAGTGACTGCGATCTTGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-714s21c1
Sequence:CCGGGTCATGTACTGGAAGCTCAACCTCGAGGTTGAGCTTCCAGTACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.2-1065s21c1
Sequence:CCGGATCAAGGAGTACCTGATTGACCTCGAGGTCAATCAGGTACTCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.2-960s21c1
Sequence:CCGGTTCCTGCAGGACGACGAAGATCTCGAGATCTTCGTCGTCCTGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1136s21c1
Sequence:CCGGCCACATCAACGCGCTCATCTTCTCGAGAAGATGAGCGCGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1722s21c1
Sequence:CCGGATGGCACAGCTGAGGAATTTCCTCGAGGAAATTCCTCAGCTGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-3185s21c1
Sequence:CCGGAGCACCCTGTTCCCTCTTTCTCTCGAGAGAAAGAGGGAACAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-3144s21c1
Sequence:CCGGAGCACTTTACAGATGAGATTCCTCGAGGAATCTCATCTGTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1596s21c1
Sequence:CCGGTTGAATTGGCCCTACCTGAAGCTCGAGCTTCAGGTAGGGCCAATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-892s21c1
Sequence:CCGGACATCGCGCTGGATGACTTTGCTCGAGCAAAGTCATCCAGCGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-408s21c1
Sequence:CCGGACAAAGGGAGACATGGAAATCCTCGAGGATTTCCATGTCTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1216s21c1
Sequence:CCGGTCTTCTACCTGTCCTTCATCTCTCGAGAGATGAAGGACAGGTAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1768s21c1
Sequence:CCGGCCTACCTGGTGTGCTTCATGTCTCGAGACATGAAGCACACCAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-2131s21c1
Sequence:CCGGCAGAGGGCATGAAGGTCTACACTCGAGTGTAGACCTTCATGCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1373s21c1
Sequence:CCGGCCTGGAGCCCTATGCCCATTTCTCGAGAAATGGGCATAGGGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006005.3-1024s21c1
Sequence:CCGGGTCTGAAGGTGGTCAAGTACCCTCGAGGGTACTTGACCACCTTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1467s21c1
Sequence:CCGGGCTGTCATCACCGGCTTCTTTCTCGAGAAAGAAGCCGGTGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-2101s21c1
Sequence:CCGGTGCTGTTCTGCTGGTTCTATGCTCGAGCATAGAACCAGCAGAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.3-1244s21c1
Sequence:CCGGGATCTGCACCCTCAAGGTGTTCTCGAGAACACCTTGAGGGTGCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006005.2-1690s21c1
Sequence:CCGGTCTATGTCTACCTGCTCTATCCTCGAGGATAGAGCAGGTAGACATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011716
VALIDATED
WFS1 MISSION shRNA Bacterial Glycerol Stock
Wolfram syndrome 1 (wolframin)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011716.1-2677s1c1
Sequence:CCGGGTTTGCCTTCGACTTCTTCTTCTCGAGAAGAAGAAGTCGAAGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011716.1-508s1c1
Sequence:CCGGGAAAGGCATCACTTCTGAGAACTCGAGTTCTCAGAAGTGATGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011716.1-392s1c1
Sequence:CCGGGCCAACGATGCAGATGAAGAACTCGAGTTCTTCATCTGCATCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011716.2-883s21c1
Sequence:CCGGAGTACGCCAAGGGCATCATTCCTCGAGGAATGATGCCCTTGGCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011716.2-2431s21c1
Sequence:CCGGAGAAGTTTGACCGCTACAAATCTCGAGATTTGTAGCGGTCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011716.2-3023s21c1
Sequence:CCGGATGCCGAGTGTCATAAGAAATCTCGAGATTTCTTATGACACTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011716.2-1009s21c1
Sequence:CCGGACGCCATCATGGAGATCAAAGCTCGAGCTTTGATCTCCATGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011716.2-1351s21c1
Sequence:CCGGTCCTACTGTCAGTCGTCTTTGCTCGAGCAAAGACGACTGACAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011716
VALIDATED
WFS1 MISSION shRNA shRNA Plasmid DNA
Wolfram syndrome 1 (wolframin)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011716.1-2677s1c1
Sequence:CCGGGTTTGCCTTCGACTTCTTCTTCTCGAGAAGAAGAAGTCGAAGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011716.1-508s1c1
Sequence:CCGGGAAAGGCATCACTTCTGAGAACTCGAGTTCTCAGAAGTGATGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011716.1-392s1c1
Sequence:CCGGGCCAACGATGCAGATGAAGAACTCGAGTTCTTCATCTGCATCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011716.2-883s21c1
Sequence:CCGGAGTACGCCAAGGGCATCATTCCTCGAGGAATGATGCCCTTGGCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011716.2-2431s21c1
Sequence:CCGGAGAAGTTTGACCGCTACAAATCTCGAGATTTGTAGCGGTCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011716.2-3023s21c1
Sequence:CCGGATGCCGAGTGTCATAAGAAATCTCGAGATTTCTTATGACACTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011716.2-1009s21c1
Sequence:CCGGACGCCATCATGGAGATCAAAGCTCGAGCTTTGATCTCCATGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011716.2-1351s21c1
Sequence:CCGGTCCTACTGTCAGTCGTCTTTGCTCGAGCAAAGACGACTGACAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011716
VALIDATED
WFS1 MISSION shRNA Lentiviral Transduction Particles
Wolfram syndrome 1 (wolframin)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011716.1-2677s1c1
Sequence:CCGGGTTTGCCTTCGACTTCTTCTTCTCGAGAAGAAGAAGTCGAAGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011716.1-508s1c1
Sequence:CCGGGAAAGGCATCACTTCTGAGAACTCGAGTTCTCAGAAGTGATGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011716.1-392s1c1
Sequence:CCGGGCCAACGATGCAGATGAAGAACTCGAGTTCTTCATCTGCATCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011716.2-883s21c1
Sequence:CCGGAGTACGCCAAGGGCATCATTCCTCGAGGAATGATGCCCTTGGCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011716.2-2431s21c1
Sequence:CCGGAGAAGTTTGACCGCTACAAATCTCGAGATTTGTAGCGGTCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011716.2-3023s21c1
Sequence:CCGGATGCCGAGTGTCATAAGAAATCTCGAGATTTCTTATGACACTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011716.2-1009s21c1
Sequence:CCGGACGCCATCATGGAGATCAAAGCTCGAGCTTTGATCTCCATGATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011716.2-1351s21c1
Sequence:CCGGTCCTACTGTCAGTCGTCTTTGCTCGAGCAAAGACGACTGACAGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks