EMAIL THIS PAGE TO A FRIEND

WHAMM

WAS protein homolog associated with actin, golgi membranes and microtubules

Synonyms: WHDC1
UniProtKB ID: Q8TF30, Q8N1J9
Gene ID:
Mouse(434204) WAS protein homolog associated with actin, golgi membranes and microtubules
Rat(293057) WAS protein homolog associated with actin, golgi membranes and microtubules
cow(510810) WAS protein homolog associated with actin, golgi membranes and microtubules
sheep(101105856) WAS protein homolog associated with actin, golgi membranes and microtubules
naked mole-rat(101702428) WAS protein homolog associated with actin, golgi membranes and microtubules
domestic guinea pig(100725323) WAS protein homolog associated with actin, golgi membranes and microtubules
Horse(100068345) WAS protein homolog associated with actin, golgi membranes and microtubules
domestic cat(101097648) WAS protein homolog associated with actin, golgi membranes and microtubules
dog(609719) WAS protein homolog associated with actin, golgi membranes and microtubules
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080435 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080435 Rosetta Predictions human pricing
XM_058720 Rosetta Predictions human pricing
XM_933294 Rosetta Predictions human pricing
XM_933298 Rosetta Predictions human pricing
XM_933300 Rosetta Predictions human pricing
XM_933305 Rosetta Predictions human pricing
NM_001130728 Rosetta Predictions rat pricing
NM_001004185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314816 predicted 2764
2 SASI_Hs02_00314817 predicted 2721
3 SASI_Hs02_00314818 predicted 2710
4 SASI_Hs02_00314819 predicted 1817
5 SASI_Hs02_00314820 predicted 2570
6 SASI_Hs02_00314821 predicted 2500
7 SASI_Hs02_00314822 predicted 2644
8 SASI_Hs02_00314823 predicted 1856
9 SASI_Hs02_00314824 predicted 2381
10 SASI_Hs02_00314825 predicted 2509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_058720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295555 predicted 2758
2 SASI_Hs01_00295556 predicted 2718
3 SASI_Hs01_00295557 predicted 1256
4 SASI_Hs01_00295558 predicted 1253
5 SASI_Hs01_00295559 predicted 1849
6 SASI_Hs01_00295560 predicted 2716
7 SASI_Hs01_00295561 predicted 2124
8 SASI_Hs01_00295562 predicted 1814
9 SASI_Hs01_00295563 predicted 2565
10 SASI_Hs01_00295564 predicted 2498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279884 predicted 426
2 SASI_Hs01_00279885 predicted 387
3 SASI_Hs01_00279886 predicted 390
4 SASI_Hs01_00279887 predicted 507
5 SASI_Hs01_00279888 predicted 523
6 SASI_Hs01_00279889 predicted 514
7 SASI_Hs01_00279890 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249589 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272158 predicted 825
2 SASI_Hs01_00272159 predicted 751
3 SASI_Hs01_00272160 predicted 658
4 SASI_Hs01_00272161 predicted 830
5 SASI_Hs01_00272162 predicted 774
6 SASI_Hs01_00272163 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252083 predicted 1759
2 SASI_Hs01_00252084 predicted 899
3 SASI_Hs01_00252085 predicted 1650
4 SASI_Hs01_00252086 predicted 1571
5 SASI_Hs01_00252087 predicted 1720
6 SASI_Hs01_00252088 predicted 1277
7 SASI_Hs01_00252089 predicted 927
8 SASI_Hs01_00252090 predicted 1462
9 SASI_Hs01_00252091 predicted 1590
10 SASI_Hs01_00252092 predicted 2003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256059 predicted 1206
2 SASI_Rn02_00256060 predicted 1126
3 SASI_Rn02_00256061 predicted 938
4 SASI_Rn02_00256062 predicted 764
5 SASI_Rn02_00256063 predicted 2357
6 SASI_Rn02_00256064 predicted 693
7 SASI_Rn02_00256065 predicted 733
8 SASI_Rn02_00256066 predicted 1264
9 SASI_Rn02_00256067 predicted 1302
10 SASI_Rn02_00256068 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120080 predicted 1252
2 SASI_Mm01_00120081 predicted 762
3 SASI_Mm01_00120082 predicted 755
4 SASI_Mm01_00120083 predicted 931
5 SASI_Mm01_00120085 predicted 1165
6 SASI_Mm01_00120086 predicted 719
7 SASI_Mm01_00120087 predicted 1114
8 SASI_Mm01_00120088 predicted 893
9 SASI_Mm01_00120089 predicted 1063
10 SASI_Mm02_00286511 predicted 640
11 SASI_Mm01_00120084 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004185
WHAMM MISSION shRNA Bacterial Glycerol Stock
WAS protein homolog associated with actin, golgi membranes and microtubules
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-687s21c1
Sequence:CCGGGCTCTATCAAGAATTAGTTACCTCGAGGTAACTAATTCTTGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-641s21c1
Sequence:CCGGCCAATACCATGGTAGCATTAACTCGAGTTAATGCTACCATGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-897s21c1
Sequence:CCGGAGACATCACTGTGAATTATTTCTCGAGAAATAATTCACAGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-1626s21c1
Sequence:CCGGTGAGCGGCTAAGAGCATATAACTCGAGTTATATGCTCTTAGCCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004185.3-2704s21c1
Sequence:CCGGATATCCCAGAATTACCTTAAACTCGAGTTTAAGGTAATTCTGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004185.2-475s1c1
Sequence:CCGGGCCAATACCATGGTAGCATTACTCGAGTAATGCTACCATGGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004185.2-517s1c1
Sequence:CCGGGATGAGCTCTATCAAGAATTACTCGAGTAATTCTTGATAGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004185.2-796s1c1
Sequence:CCGGGAGCAGGATCAGAAGAGATTTCTCGAGAAATCTCTTCTGATCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004185
WHAMM MISSION shRNA shRNA Plasmid DNA
WAS protein homolog associated with actin, golgi membranes and microtubules
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-687s21c1
Sequence:CCGGGCTCTATCAAGAATTAGTTACCTCGAGGTAACTAATTCTTGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-641s21c1
Sequence:CCGGCCAATACCATGGTAGCATTAACTCGAGTTAATGCTACCATGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-897s21c1
Sequence:CCGGAGACATCACTGTGAATTATTTCTCGAGAAATAATTCACAGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-1626s21c1
Sequence:CCGGTGAGCGGCTAAGAGCATATAACTCGAGTTATATGCTCTTAGCCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004185.3-2704s21c1
Sequence:CCGGATATCCCAGAATTACCTTAAACTCGAGTTTAAGGTAATTCTGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004185.2-475s1c1
Sequence:CCGGGCCAATACCATGGTAGCATTACTCGAGTAATGCTACCATGGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004185.2-517s1c1
Sequence:CCGGGATGAGCTCTATCAAGAATTACTCGAGTAATTCTTGATAGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004185.2-796s1c1
Sequence:CCGGGAGCAGGATCAGAAGAGATTTCTCGAGAAATCTCTTCTGATCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004185
WHAMM MISSION shRNA Lentiviral Transduction Particles
WAS protein homolog associated with actin, golgi membranes and microtubules
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-687s21c1
Sequence:CCGGGCTCTATCAAGAATTAGTTACCTCGAGGTAACTAATTCTTGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-641s21c1
Sequence:CCGGCCAATACCATGGTAGCATTAACTCGAGTTAATGCTACCATGGTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-897s21c1
Sequence:CCGGAGACATCACTGTGAATTATTTCTCGAGAAATAATTCACAGTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004185.3-1626s21c1
Sequence:CCGGTGAGCGGCTAAGAGCATATAACTCGAGTTATATGCTCTTAGCCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004185.3-2704s21c1
Sequence:CCGGATATCCCAGAATTACCTTAAACTCGAGTTTAAGGTAATTCTGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004185.2-475s1c1
Sequence:CCGGGCCAATACCATGGTAGCATTACTCGAGTAATGCTACCATGGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004185.2-517s1c1
Sequence:CCGGGATGAGCTCTATCAAGAATTACTCGAGTAATTCTTGATAGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004185.2-796s1c1
Sequence:CCGGGAGCAGGATCAGAAGAGATTTCTCGAGAAATCTCTTCTGATCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080435
WHAMM MISSION shRNA Bacterial Glycerol Stock
WAS protein homolog associated with actin, golgi membranes and microtubules
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2244s21c1
Sequence:CCGGTCCCACGCGGTGTCAGTAATTCTCGAGAATTACTGACACCGCGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080435.1-3929s21c1
Sequence:CCGGACTGGTAAGCAGTACTATTAGCTCGAGCTAATAGTACTGCTTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2369s21c1
Sequence:CCGGTGTTCCAGTTGGTGATCAAACCTCGAGGTTTGATCACCAACTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2296s21c1
Sequence:CCGGCCCTATCGGAAGCTGGTAATGCTCGAGCATTACCAGCTTCCGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2927s21c1
Sequence:CCGGGGATGGTTAGGCTCAAGTTTGCTCGAGCAAACTTGAGCCTAACCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080435
WHAMM MISSION shRNA shRNA Plasmid DNA
WAS protein homolog associated with actin, golgi membranes and microtubules
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2244s21c1
Sequence:CCGGTCCCACGCGGTGTCAGTAATTCTCGAGAATTACTGACACCGCGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080435.1-3929s21c1
Sequence:CCGGACTGGTAAGCAGTACTATTAGCTCGAGCTAATAGTACTGCTTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2369s21c1
Sequence:CCGGTGTTCCAGTTGGTGATCAAACCTCGAGGTTTGATCACCAACTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2296s21c1
Sequence:CCGGCCCTATCGGAAGCTGGTAATGCTCGAGCATTACCAGCTTCCGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2927s21c1
Sequence:CCGGGGATGGTTAGGCTCAAGTTTGCTCGAGCAAACTTGAGCCTAACCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080435
WHAMM MISSION shRNA Lentiviral Transduction Particles
WAS protein homolog associated with actin, golgi membranes and microtubules
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2244s21c1
Sequence:CCGGTCCCACGCGGTGTCAGTAATTCTCGAGAATTACTGACACCGCGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080435.1-3929s21c1
Sequence:CCGGACTGGTAAGCAGTACTATTAGCTCGAGCTAATAGTACTGCTTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2369s21c1
Sequence:CCGGTGTTCCAGTTGGTGATCAAACCTCGAGGTTTGATCACCAACTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2296s21c1
Sequence:CCGGCCCTATCGGAAGCTGGTAATGCTCGAGCATTACCAGCTTCCGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080435.1-2927s21c1
Sequence:CCGGGGATGGTTAGGCTCAAGTTTGCTCGAGCAAACTTGAGCCTAACCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks