EMAIL THIS PAGE TO A FRIEND

WHSC1

Wolf-Hirschhorn syndrome candidate 1

Synonyms: MMSET NSD2 REIIBP TRX5 WHS
Gene ID:
Human(7468) Summary: This gene encodes a protein that contains four domains present in other developmental proteins: a PWWP domain, an HMG box, a SET domain, and a PHD-type zinc finger. It is expressed ubiquitously in early development. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene maps to the 165 kb WHS critical region and has also been involved in the chromosomal translocation t(4;14)(p16.3;q32.3) in multiple myelomas. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Some transcript variants are nonsense-mediated mRNA (NMD) decay candidates, hence not represented as reference sequences. [provided by RefSeq, Jul 2008]
Mouse(107823) Wolf-Hirschhorn syndrome candidate 1 (human)
Rat(680537) Wolf-Hirschhorn syndrome candidate 1
cow(540769) Wolf-Hirschhorn syndrome candidate 1
sheep(101103648) Wolf-Hirschhorn syndrome candidate 1
domestic guinea pig(100713660) Wolf-Hirschhorn syndrome candidate 1
naked mole-rat(101709487) Wolf-Hirschhorn syndrome candidate 1
Zebrafish(100000709) Wolf-Hirschhorn syndrome candidate 1
domestic cat(101083169) Wolf-Hirschhorn syndrome candidate 1
Horse(100051090) Wolf-Hirschhorn syndrome candidate 1
chicken(422897) Wolf-Hirschhorn syndrome candidate 1
dog(479077) Wolf-Hirschhorn syndrome candidate 1
406 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007331 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063351 MISSION® esiRNA esiRNA human WHSC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042424 Rosetta Predictions human pricing
NM_007331 Rosetta Predictions human pricing
NM_014919 Rosetta Predictions human pricing
NM_133330 Rosetta Predictions human pricing
NM_133331 Rosetta Predictions human pricing
NM_133332 Rosetta Predictions human pricing
NM_133333 Rosetta Predictions human pricing
NM_133334 Rosetta Predictions human pricing
NM_133335 Rosetta Predictions human pricing
NM_133336 Rosetta Predictions human pricing
XM_001058223 Rosetta Predictions rat pricing
XM_001058413 Rosetta Predictions rat pricing
XM_001058474 Rosetta Predictions rat pricing
NM_001081102 Rosetta Predictions mouse pricing
XM_132006 Rosetta Predictions mouse pricing
XM_898278 Rosetta Predictions mouse pricing
XM_898287 Rosetta Predictions mouse pricing
XM_898298 Rosetta Predictions mouse pricing
XM_898312 Rosetta Predictions mouse pricing
XM_898318 Rosetta Predictions mouse pricing
XM_898331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309678 predicted 407
2 SASI_Hs02_00309679 predicted 1715
3 SASI_Hs02_00309680 predicted 1342
4 SASI_Hs02_00309681 predicted 581
5 SASI_Hs02_00309682 predicted 810
6 SASI_Hs02_00309683 predicted 811
7 SASI_Hs02_00309684 predicted 828
8 SASI_Hs02_00309685 predicted 837
9 SASI_Hs02_00309686 predicted 809
10 SASI_Hs02_00309687 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023421 predicted 726
2 SASI_Hs01_00023424 predicted 2032
3 SASI_Hs01_00023425 predicted 1661
4 SASI_Hs01_00023426 predicted 902
5 SASI_Hs01_00023427 predicted 1128
6 SASI_Hs01_00023428 predicted 1126
7 SASI_Hs01_00023429 predicted 1143
8 SASI_Hs02_00343409 predicted 1157
9 SASI_Hs02_00343410 predicted 1127
10 SASI_Hs02_00343411 predicted 2074
11 SASI_Hs01_00023420 predicted 1239
12 SASI_Hs01_00023422 predicted 1519
13 SASI_Hs01_00023423 predicted 1523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215817 predicted 1247
2 SASI_Hs01_00215818 predicted 2268
3 SASI_Hs01_00215819 predicted 737
4 SASI_Hs01_00215820 predicted 1516
5 SASI_Hs01_00215821 predicted 2364
6 SASI_Hs01_00215822 predicted 525
7 SASI_Hs01_00215823 predicted 2035
8 SASI_Hs01_00215824 predicted 1664
9 SASI_Hs01_00215825 predicted 1131
10 SASI_Hs01_00215826 predicted 2805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363001 predicted 732
2 SASI_Hs02_00363002 predicted 2033
3 SASI_Hs02_00363003 predicted 1664
4 SASI_Hs02_00363004 predicted 901
5 SASI_Hs02_00363005 predicted 1121
6 SASI_Hs02_00363006 predicted 1126
7 SASI_Hs02_00363007 predicted 1143
8 SASI_Hs02_00363008 predicted 1158
9 SASI_Hs02_00363009 predicted 1125
10 SASI_Hs02_00363010 predicted 2076
11 SASI_Hs01_00220902 predicted 3499
12 SASI_Hs01_00220903 predicted 4905
13 SASI_Hs01_00220904 predicted 3385
14 SASI_Hs01_00220905 predicted 3747
15 SASI_Hs01_00220906 predicted 3481
16 SASI_Hs01_00220907 predicted 4850
17 SASI_Hs01_00220908 predicted 3754
18 SASI_Hs01_00220909 predicted 4933
19 SASI_Hs01_00220910 predicted 4902
20 SASI_Hs01_00220911 predicted 3564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363011 predicted 552
2 SASI_Hs02_00363012 predicted 1858
3 SASI_Hs02_00363013 predicted 1481
4 SASI_Hs02_00363014 predicted 725
5 SASI_Hs02_00363015 predicted 941
6 SASI_Hs02_00363016 predicted 943
7 SASI_Hs02_00363017 predicted 963
8 SASI_Hs02_00363018 predicted 975
9 SASI_Hs02_00363019 predicted 947
10 SASI_Hs02_00363020 predicted 1900
11 SASI_Hs01_00193045 predicted 3322
12 SASI_Hs01_00193046 predicted 4727
13 SASI_Hs01_00193047 predicted 3198
14 SASI_Hs01_00193048 predicted 3568
15 SASI_Hs01_00193049 predicted 3299
16 SASI_Hs01_00193050 predicted 4670
17 SASI_Hs01_00193051 predicted 3567
18 SASI_Hs01_00193052 predicted 4751
19 SASI_Hs01_00193053 predicted 4721
20 SASI_Hs01_00193054 predicted 3380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133254 predicted 1239
2 SASI_Hs01_00133255 predicted 2268
3 SASI_Hs01_00133256 predicted 730
4 SASI_Hs01_00133257 predicted 1518
5 SASI_Hs01_00133258 predicted 525
6 SASI_Hs01_00133259 predicted 2038
7 SASI_Hs01_00133260 predicted 1662
8 SASI_Hs01_00133261 predicted 903
9 SASI_Hs01_00133262 predicted 1130
10 SASI_Hs01_00133263 predicted 2523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200707 predicted 1241
2 SASI_Hs01_00200708 predicted 2260
3 SASI_Hs01_00200709 predicted 738
4 SASI_Hs01_00200710 predicted 1519
5 SASI_Hs01_00200711 predicted 530
6 SASI_Hs01_00200712 predicted 2045
7 SASI_Hs01_00200713 predicted 1667
8 SASI_Hs01_00200714 predicted 903
9 SASI_Hs01_00200715 predicted 1124
10 SASI_Hs01_00200716 predicted 2510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158127 predicted 268
2 SASI_Hs01_00158130 predicted 1565
3 SASI_Hs01_00158131 predicted 1196
4 SASI_Hs01_00158132 predicted 439
5 SASI_Hs01_00158133 predicted 657
6 SASI_Hs01_00158134 predicted 662
7 SASI_Hs01_00158135 predicted 678
8 SASI_Hs02_00363021 predicted 689
9 SASI_Hs02_00363022 predicted 657
10 SASI_Hs02_00363023 predicted 1615
11 SASI_Hs01_00158126 predicted 783
12 SASI_Hs01_00158128 predicted 1053
13 SASI_Hs01_00158129 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363024 predicted 370
2 SASI_Hs02_00363025 predicted 1680
3 SASI_Hs02_00363026 predicted 1303
4 SASI_Hs02_00363027 predicted 543
5 SASI_Hs02_00363028 predicted 764
6 SASI_Hs02_00363029 predicted 777
7 SASI_Hs02_00363030 predicted 786
8 SASI_Hs02_00363031 predicted 800
9 SASI_Hs02_00363032 predicted 774
10 SASI_Hs02_00363033 predicted 1721
11 SASI_Hs01_00068067 predicted 3143
12 SASI_Hs01_00068068 predicted 4547
13 SASI_Hs01_00068069 predicted 3028
14 SASI_Hs01_00068070 predicted 3383
15 SASI_Hs01_00068071 predicted 3124
16 SASI_Hs01_00068072 predicted 4489
17 SASI_Hs01_00068073 predicted 3399
18 SASI_Hs01_00068074 predicted 4581
19 SASI_Hs01_00068075 predicted 4544
20 SASI_Hs01_00068076 predicted 3206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169643 predicted 1624
2 SASI_Hs01_00169644 predicted 3031
3 SASI_Hs01_00169645 predicted 1505
4 SASI_Hs01_00169646 predicted 1863
5 SASI_Hs01_00169647 predicted 1610
6 SASI_Hs01_00169648 predicted 2973
7 SASI_Hs01_00169649 predicted 1876
8 SASI_Hs01_00169650 predicted 3053
9 SASI_Hs01_00169651 predicted 3022
10 SASI_Hs01_00169652 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289027 predicted 445
2 SASI_Rn02_00289028 predicted 3748
3 SASI_Rn02_00289029 predicted 2757
4 SASI_Rn02_00289030 predicted 3064
5 SASI_Rn02_00289031 predicted 1531
6 SASI_Rn02_00289032 predicted 1682
7 SASI_Rn02_00289033 predicted 699
8 SASI_Rn02_00289034 predicted 963
9 SASI_Rn02_00289035 predicted 3150
10 SASI_Rn02_00289036 predicted 3676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289613 predicted 443
2 SASI_Rn02_00289614 predicted 4122
3 SASI_Rn02_00289615 predicted 3127
4 SASI_Rn02_00289616 predicted 3431
5 SASI_Rn02_00289617 predicted 1528
6 SASI_Rn02_00289618 predicted 696
7 SASI_Rn02_00289619 predicted 970
8 SASI_Rn02_00289620 predicted 3519
9 SASI_Rn02_00289621 predicted 4046
10 SASI_Rn02_00289622 predicted 2179
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289869 predicted 447
2 SASI_Rn02_00289870 predicted 4125
3 SASI_Rn02_00289871 predicted 3128
4 SASI_Rn02_00289872 predicted 3427
5 SASI_Rn02_00289873 predicted 1528
6 SASI_Rn02_00289874 predicted 1682
7 SASI_Rn02_00289875 predicted 700
8 SASI_Rn02_00289876 predicted 967
9 SASI_Rn02_00289877 predicted 3517
10 SASI_Rn02_00289878 predicted 4047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295201 predicted 3928
2 SASI_Mm02_00295202 predicted 3473
3 SASI_Mm02_00295203 predicted 3976
4 SASI_Mm02_00295204 predicted 1529
5 SASI_Mm02_00295205 predicted 1576
6 SASI_Mm02_00295206 predicted 735
7 SASI_Mm02_00295207 predicted 3079
8 SASI_Mm02_00295208 predicted 2946
9 SASI_Mm02_00295209 predicted 2217
10 SASI_Mm02_00295210 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227936 predicted 656
2 SASI_Mm01_00227937 predicted 3487
3 SASI_Mm01_00227938 predicted 495
4 SASI_Mm01_00227939 predicted 3977
5 SASI_Mm01_00227940 predicted 1528
6 SASI_Mm01_00227941 predicted 1581
7 SASI_Mm01_00227942 predicted 746
8 SASI_Mm01_00227943 predicted 2221
9 SASI_Mm01_00227944 predicted 414
10 SASI_Mm01_00227945 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218308 predicted 1723
2 SASI_Mm01_00218309 predicted 1138
3 SASI_Mm01_00218310 predicted 2432
4 SASI_Mm01_00218311 predicted 1766
5 SASI_Mm01_00218312 predicted 1850
6 SASI_Mm01_00218313 predicted 1969
7 SASI_Mm01_00218314 predicted 1417
8 SASI_Mm01_00218315 predicted 2356
9 SASI_Mm01_00218316 predicted 1449
10 SASI_Mm01_00218317 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278608 predicted 658
2 SASI_Mm01_00278609 predicted 3051
3 SASI_Mm01_00278610 predicted 493
4 SASI_Mm01_00278611 predicted 1529
5 SASI_Mm01_00278612 predicted 1576
6 SASI_Mm01_00278613 predicted 1989
7 SASI_Mm01_00278614 predicted 749
8 SASI_Mm01_00278615 predicted 3085
9 SASI_Mm01_00278616 predicted 2219
10 SASI_Mm01_00278617 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277411 predicted 1202
2 SASI_Mm01_00277412 predicted 1164
3 SASI_Mm01_00277413 predicted 779
4 SASI_Mm01_00277414 predicted 286
5 SASI_Mm01_00277415 predicted 716
6 SASI_Mm01_00277416 predicted 758
7 SASI_Mm01_00277417 predicted 1295
8 SASI_Mm01_00277418 predicted 1267
9 SASI_Mm01_00277419 predicted 1242
10 SASI_Mm01_00277420 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202377 predicted 3353
2 SASI_Mm01_00202378 predicted 658
3 SASI_Mm01_00202379 predicted 494
4 SASI_Mm01_00202380 predicted 1534
5 SASI_Mm01_00202381 predicted 1581
6 SASI_Mm01_00202382 predicted 749
7 SASI_Mm01_00202383 predicted 2229
8 SASI_Mm01_00202384 predicted 408
9 SASI_Mm01_00202385 predicted 1478
10 SASI_Mm01_00202386 predicted 3385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233515 predicted 3411
2 SASI_Mm01_00233516 predicted 2830
3 SASI_Mm01_00233517 predicted 4118
4 SASI_Mm01_00233518 predicted 3463
5 SASI_Mm01_00233519 predicted 3544
6 SASI_Mm01_00233520 predicted 3658
7 SASI_Mm01_00233521 predicted 3110
8 SASI_Mm01_00233522 predicted 4042
9 SASI_Mm01_00233523 predicted 3139
10 SASI_Mm01_00233524 predicted 3153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214914 predicted 2014
2 SASI_Mm01_00214915 predicted 1983
3 SASI_Mm01_00214916 predicted 649
4 SASI_Mm01_00214917 predicted 490
5 SASI_Mm01_00214918 predicted 1529
6 SASI_Mm01_00214919 predicted 1580
7 SASI_Mm01_00214920 predicted 2118
8 SASI_Mm01_00214921 predicted 748
9 SASI_Mm01_00214922 predicted 2080
10 SASI_Mm01_00214923 predicted 410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007331
VALIDATED
WHSC1 MISSION shRNA Bacterial Glycerol Stock
Wolf-Hirschhorn syndrome candidate 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-554s21c1
Sequence:CCGGGATGAAGCAGGCACCAGAAATCTCGAGATTTCTGGTGCCTGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-3384s21c1
Sequence:CCGGCCTCAGTTGTTTCCACTCATTCTCGAGAATGAGTGGAAACAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-1512s21c1
Sequence:CCGGCGGAAAGCCAAGTTCACCTTTCTCGAGAAAGGTGAACTTGGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-1304s21c1
Sequence:CCGGCCCAGAAAGAGCTTGGATATTCTCGAGAATATCCAAGCTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-736s21c1
Sequence:CCGGATCTTACTTCCCGGGTGTTTACTCGAGTAAACACCCGGGAAGTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-3384s1c1
Sequence:CCGGCCTCAGTTGTTTCCACTCATTCTCGAGAATGAGTGGAAACAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-1512s1c1
Sequence:CCGGCGGAAAGCCAAGTTCACCTTTCTCGAGAAAGGTGAACTTGGCTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-1304s1c1
Sequence:CCGGCCCAGAAAGAGCTTGGATATTCTCGAGAATATCCAAGCTCTTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-903s1c1
Sequence:CCGGCCTCTCTTTGAATCTTCCATTCTCGAGAATGGAAGATTCAAAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-1992s1c1
Sequence:CCGGGCACGCTACAACACCAAGTTTCTCGAGAAACTTGGTGTTGTAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007331
VALIDATED
WHSC1 MISSION shRNA shRNA Plasmid DNA
Wolf-Hirschhorn syndrome candidate 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-554s21c1
Sequence:CCGGGATGAAGCAGGCACCAGAAATCTCGAGATTTCTGGTGCCTGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-3384s21c1
Sequence:CCGGCCTCAGTTGTTTCCACTCATTCTCGAGAATGAGTGGAAACAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-1512s21c1
Sequence:CCGGCGGAAAGCCAAGTTCACCTTTCTCGAGAAAGGTGAACTTGGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-1304s21c1
Sequence:CCGGCCCAGAAAGAGCTTGGATATTCTCGAGAATATCCAAGCTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-736s21c1
Sequence:CCGGATCTTACTTCCCGGGTGTTTACTCGAGTAAACACCCGGGAAGTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-3384s1c1
Sequence:CCGGCCTCAGTTGTTTCCACTCATTCTCGAGAATGAGTGGAAACAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-1512s1c1
Sequence:CCGGCGGAAAGCCAAGTTCACCTTTCTCGAGAAAGGTGAACTTGGCTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-1304s1c1
Sequence:CCGGCCCAGAAAGAGCTTGGATATTCTCGAGAATATCCAAGCTCTTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-903s1c1
Sequence:CCGGCCTCTCTTTGAATCTTCCATTCTCGAGAATGGAAGATTCAAAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-1992s1c1
Sequence:CCGGGCACGCTACAACACCAAGTTTCTCGAGAAACTTGGTGTTGTAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007331
VALIDATED
WHSC1 MISSION shRNA Lentiviral Transduction Particles
Wolf-Hirschhorn syndrome candidate 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-554s21c1
Sequence:CCGGGATGAAGCAGGCACCAGAAATCTCGAGATTTCTGGTGCCTGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-3384s21c1
Sequence:CCGGCCTCAGTTGTTTCCACTCATTCTCGAGAATGAGTGGAAACAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-1512s21c1
Sequence:CCGGCGGAAAGCCAAGTTCACCTTTCTCGAGAAAGGTGAACTTGGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-1304s21c1
Sequence:CCGGCCCAGAAAGAGCTTGGATATTCTCGAGAATATCCAAGCTCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007331.1-736s21c1
Sequence:CCGGATCTTACTTCCCGGGTGTTTACTCGAGTAAACACCCGGGAAGTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-3384s1c1
Sequence:CCGGCCTCAGTTGTTTCCACTCATTCTCGAGAATGAGTGGAAACAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-1512s1c1
Sequence:CCGGCGGAAAGCCAAGTTCACCTTTCTCGAGAAAGGTGAACTTGGCTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-1304s1c1
Sequence:CCGGCCCAGAAAGAGCTTGGATATTCTCGAGAATATCCAAGCTCTTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-903s1c1
Sequence:CCGGCCTCTCTTTGAATCTTCCATTCTCGAGAATGGAAGATTCAAAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007331.1-1992s1c1
Sequence:CCGGGCACGCTACAACACCAAGTTTCTCGAGAAACTTGGTGTTGTAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081102
VALIDATED
WHSC1 MISSION shRNA Bacterial Glycerol Stock
Wolf-Hirschhorn syndrome candidate 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-807s21c1
Sequence:CCGGCCCACTCCTTCACAATCATACCTCGAGGTATGATTGTGAAGGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081102.1-4566s21c1
Sequence:CCGGCTGATGGTGCAGGCTTCTATTCTCGAGAATAGAAGCCTGCACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-3444s21c1
Sequence:CCGGCATAGACAAGGACCGCATAATCTCGAGATTATGCGGTCCTTGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-889s21c1
Sequence:GTACCGGCCAGAAAGAGCTTGGATATTTCTCGAGAAATATCCAAGCTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-4637s21c1
Sequence:CCGGCTTCCGATCAGGATTGGTAATCTCGAGATTACCAATCCTGATCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-3600s21c1
Sequence:CCGGAGAGCTGACTTTCAACTATAACTCGAGTTATAGTTGAAAGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-349s21c1
Sequence:CCGGCCTGGTGCTCATGATACTAAACTCGAGTTTAGTATCATGAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-1244s21c1
Sequence:CCGGCTGTGAGAGAAGAGGATATTCCTCGAGGAATATCCTCTTCTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-3067s21c1
Sequence:CCGGGTGAATAAACCTTATGGTAAACTCGAGTTTACCATAAGGTTTATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081102
VALIDATED
WHSC1 MISSION shRNA shRNA Plasmid DNA
Wolf-Hirschhorn syndrome candidate 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-807s21c1
Sequence:CCGGCCCACTCCTTCACAATCATACCTCGAGGTATGATTGTGAAGGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081102.1-4566s21c1
Sequence:CCGGCTGATGGTGCAGGCTTCTATTCTCGAGAATAGAAGCCTGCACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-3444s21c1
Sequence:CCGGCATAGACAAGGACCGCATAATCTCGAGATTATGCGGTCCTTGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-889s21c1
Sequence:GTACCGGCCAGAAAGAGCTTGGATATTTCTCGAGAAATATCCAAGCTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-4637s21c1
Sequence:CCGGCTTCCGATCAGGATTGGTAATCTCGAGATTACCAATCCTGATCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-3600s21c1
Sequence:CCGGAGAGCTGACTTTCAACTATAACTCGAGTTATAGTTGAAAGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-349s21c1
Sequence:CCGGCCTGGTGCTCATGATACTAAACTCGAGTTTAGTATCATGAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-1244s21c1
Sequence:CCGGCTGTGAGAGAAGAGGATATTCCTCGAGGAATATCCTCTTCTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-3067s21c1
Sequence:CCGGGTGAATAAACCTTATGGTAAACTCGAGTTTACCATAAGGTTTATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081102
VALIDATED
WHSC1 MISSION shRNA Lentiviral Transduction Particles
Wolf-Hirschhorn syndrome candidate 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-807s21c1
Sequence:CCGGCCCACTCCTTCACAATCATACCTCGAGGTATGATTGTGAAGGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081102.1-4566s21c1
Sequence:CCGGCTGATGGTGCAGGCTTCTATTCTCGAGAATAGAAGCCTGCACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-3444s21c1
Sequence:CCGGCATAGACAAGGACCGCATAATCTCGAGATTATGCGGTCCTTGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-889s21c1
Sequence:GTACCGGCCAGAAAGAGCTTGGATATTTCTCGAGAAATATCCAAGCTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-4637s21c1
Sequence:CCGGCTTCCGATCAGGATTGGTAATCTCGAGATTACCAATCCTGATCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-3600s21c1
Sequence:CCGGAGAGCTGACTTTCAACTATAACTCGAGTTATAGTTGAAAGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-349s21c1
Sequence:CCGGCCTGGTGCTCATGATACTAAACTCGAGTTTAGTATCATGAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-1244s21c1
Sequence:CCGGCTGTGAGAGAAGAGGATATTCCTCGAGGAATATCCTCTTCTCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081102.1-3067s21c1
Sequence:CCGGGTGAATAAACCTTATGGTAAACTCGAGTTTACCATAAGGTTTATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks