EMAIL THIS PAGE TO A FRIEND

WHSC1L1

Wolf-Hirschhorn syndrome candidate 1-like 1

Synonyms: NSD3 pp14328
Gene ID:
Human(54904) Summary: This gene is related to the Wolf-Hirschhorn syndrome candidate-1 gene and encodes a protein with PWWP (proline-tryptophan-tryptophan-proline) domains. The function of the protein has not been determined. Two alternatively spliced variants have been described. [provided by RefSeq, Jul 2008]
Mouse(234135) Wolf-Hirschhorn syndrome candidate 1-like 1 (human)
Rat(290831) Wolf-Hirschhorn syndrome candidate 1-like 1
Zebrafish(100006350) Wolf-Hirschhorn syndrome candidate 1-like 1
Horse(100057692) Wolf-Hirschhorn syndrome candidate 1-like 1
chicken(426778) Wolf-Hirschhorn syndrome candidate 1-like 1
dog(475584) Wolf-Hirschhorn syndrome candidate 1-like 1
naked mole-rat(101703406) Wolf-Hirschhorn syndrome candidate 1-like 1
Domestic Rabbit(100352710) Wolf-Hirschhorn syndrome candidate 1-like 1
domestic guinea pig(100731623) Wolf-Hirschhorn syndrome candidate 1-like 1
cow(513054) Wolf-Hirschhorn syndrome candidate 1-like 1
sheep(101112880) Wolf-Hirschhorn syndrome candidate 1-like 1
287 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017778 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059551 MISSION® esiRNA esiRNA human WHSC1L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017778 Rosetta Predictions human pricing
NM_023034 Rosetta Predictions human pricing
NM_001106090 Rosetta Predictions rat pricing
NM_001001735 Rosetta Predictions mouse pricing
NM_001081269 Rosetta Predictions mouse pricing
XM_620640 Rosetta Predictions mouse pricing
XM_900352 Rosetta Predictions mouse pricing
XM_900362 Rosetta Predictions mouse pricing
XM_900376 Rosetta Predictions mouse pricing
XM_900395 Rosetta Predictions mouse pricing
XM_900401 Rosetta Predictions mouse pricing
XM_987322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082040 predicted 722
2 SASI_Hs01_00082041 predicted 1843
3 SASI_Hs01_00082042 predicted 2062
4 SASI_Hs02_00350617 predicted 2062
5 SASI_Hs01_00082043 predicted 2138
6 SASI_Hs01_00082044 predicted 574
7 SASI_Hs01_00082045 predicted 1493
8 SASI_Hs01_00082046 predicted 697
9 SASI_Hs02_00350618 predicted 842
10 SASI_Hs01_00082048 predicted 611
11 SASI_Hs01_00082047 predicted 771
12 SASI_Hs01_00082049 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105577 predicted 715
2 SASI_Hs01_00105578 predicted 1842
3 SASI_Hs01_00105579 predicted 2060
4 SASI_Hs02_00356293 predicted 2057
5 SASI_Hs01_00105580 predicted 2140
6 SASI_Hs01_00105581 predicted 575
7 SASI_Hs01_00105582 predicted 1493
8 SASI_Hs01_00105583 predicted 696
9 SASI_Hs02_00356294 predicted 843
10 SASI_Hs01_00105585 predicted 606
11 SASI_Hs01_00105584 predicted 772
12 SASI_Hs01_00105586 predicted 1710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215532 predicted 3132
2 SASI_Rn02_00215533 predicted 1859
3 SASI_Rn02_00215534 predicted 1823
4 SASI_Rn02_00215535 predicted 4218
5 SASI_Rn02_00215536 predicted 3337
6 SASI_Rn02_00215537 predicted 4306
7 SASI_Rn02_00215538 predicted 1376
8 SASI_Rn02_00215539 predicted 2969
9 SASI_Rn02_00215540 predicted 3609
10 SASI_Rn02_00215541 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286192 predicted 1832
2 SASI_Mm02_00286193 predicted 1488
3 SASI_Mm02_00286194 predicted 2012
4 SASI_Mm02_00286195 predicted 1929
5 SASI_Mm02_00286196 predicted 1405
6 SASI_Mm02_00286197 predicted 1971
7 SASI_Mm02_00286198 predicted 1657
8 SASI_Mm02_00286199 predicted 1772
9 SASI_Mm02_00286200 predicted 1665
10 SASI_Mm02_00286201 predicted 2076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296817 predicted 1691
2 SASI_Mm02_00296818 predicted 1342
3 SASI_Mm02_00296819 predicted 1872
4 SASI_Mm02_00296820 predicted 1797
5 SASI_Mm02_00296821 predicted 1267
6 SASI_Mm02_00296822 predicted 1827
7 SASI_Mm02_00296823 predicted 1520
8 SASI_Mm02_00296824 predicted 1631
9 SASI_Mm02_00296825 predicted 1527
10 SASI_Mm02_00296826 predicted 1931
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247066 predicted 1701
2 SASI_Mm01_00247067 predicted 1349
3 SASI_Mm01_00247068 predicted 1882
4 SASI_Mm01_00247069 predicted 1799
5 SASI_Mm01_00247070 predicted 1265
6 SASI_Mm01_00247071 predicted 1838
7 SASI_Mm01_00247072 predicted 1528
8 SASI_Mm01_00247073 predicted 1638
9 SASI_Mm01_00247074 predicted 1943
10 SASI_Mm01_00247075 predicted 1923
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218239 predicted 1856
2 SASI_Mm01_00218240 predicted 1516
3 SASI_Mm01_00218241 predicted 1959
4 SASI_Mm01_00218242 predicted 1433
5 SASI_Mm01_00218243 predicted 1992
6 SASI_Mm01_00218244 predicted 652
7 SASI_Mm01_00218245 predicted 1682
8 SASI_Mm01_00218246 predicted 1801
9 SASI_Mm01_00218247 predicted 2104
10 SASI_Mm01_00218248 predicted 2088
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278133 predicted 233
2 SASI_Mm01_00278134 predicted 244
3 SASI_Mm01_00278135 predicted 235
4 SASI_Mm01_00278136 predicted 237
5 SASI_Mm01_00278137 predicted 209
6 SASI_Mm01_00278138 predicted 428
7 SASI_Mm01_00278139 predicted 174
8 SASI_Mm01_00278140 predicted 72
9 SASI_Mm01_00278141 predicted 553
10 SASI_Mm01_00278142 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259551 predicted 1819
2 SASI_Mm01_00259552 predicted 1478
3 SASI_Mm01_00259553 predicted 601
4 SASI_Mm01_00259554 predicted 1392
5 SASI_Mm01_00259555 predicted 612
6 SASI_Mm01_00259556 predicted 1650
7 SASI_Mm01_00259557 predicted 1756
8 SASI_Mm01_00259558 predicted 525
9 SASI_Mm01_00259559 predicted 493
10 SASI_Mm01_00259560 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208629 predicted 1803
2 SASI_Mm01_00208630 predicted 1453
3 SASI_Mm01_00208631 predicted 1984
4 SASI_Mm01_00208632 predicted 2195
5 SASI_Mm01_00208633 predicted 1896
6 SASI_Mm01_00208634 predicted 1371
7 SASI_Mm01_00208635 predicted 1938
8 SASI_Mm01_00208636 predicted 1620
9 SASI_Mm01_00208637 predicted 1732
10 SASI_Mm01_00208638 predicted 2046
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203714 predicted 1097
2 SASI_Mm01_00203715 predicted 1000
3 SASI_Mm01_00203716 predicted 1247
4 SASI_Mm01_00203717 predicted 933
5 SASI_Mm01_00203718 predicted 365
6 SASI_Mm01_00203719 predicted 954
7 SASI_Mm01_00203720 predicted 1302
8 SASI_Mm01_00203721 predicted 1542
9 SASI_Mm01_00203722 predicted 972
10 SASI_Mm01_00203723 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_987322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245801 predicted 518
2 SASI_Mm01_00245802 predicted 1293
3 SASI_Mm01_00245803 predicted 1059
4 SASI_Mm01_00245804 predicted 687
5 SASI_Mm01_00245805 predicted 754
6 SASI_Mm01_00245806 predicted 926
7 SASI_Mm01_00245807 predicted 689
8 SASI_Mm01_00245808 predicted 1009
9 SASI_Mm01_00245809 predicted 920
10 SASI_Mm01_00245810 predicted 690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017778
WHSC1L1 MISSION shRNA Bacterial Glycerol Stock
Wolf-Hirschhorn syndrome candidate 1-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1500s1c1
Sequence:CCGGCGAGAGTATAAAGGTCATAAACTCGAGTTTATGACCTTTATACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-738s1c1
Sequence:CCGGCCATCATCAATCAGTGTGTATCTCGAGATACACACTGATTGATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1434s1c1
Sequence:CCGGCGAGAATATCATGTCCAGTTTCTCGAGAAACTGGACATGATATTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1009s1c1
Sequence:CCGGGCAGGGAATTGTTTGAGTCTTCTCGAGAAGACTCAAACAATTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1959s1c1
Sequence:CCGGGCTTCCATTACGATGCACAAACTCGAGTTTGTGCATCGTAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017778.2-2565s21c1
Sequence:CCGGCAATCATCATTATTGGCATTTCTCGAGAAATGCCAATAATGATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017778.2-768s21c1
Sequence:CCGGACCAAATACCAGTCATATAATCTCGAGATTATATGACTGGTATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017778.2-2617s21c1
Sequence:CCGGCAATTGCTTTAACAGTCAAATCTCGAGATTTGACTGTTAAAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017778
WHSC1L1 MISSION shRNA shRNA Plasmid DNA
Wolf-Hirschhorn syndrome candidate 1-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1500s1c1
Sequence:CCGGCGAGAGTATAAAGGTCATAAACTCGAGTTTATGACCTTTATACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-738s1c1
Sequence:CCGGCCATCATCAATCAGTGTGTATCTCGAGATACACACTGATTGATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1434s1c1
Sequence:CCGGCGAGAATATCATGTCCAGTTTCTCGAGAAACTGGACATGATATTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1009s1c1
Sequence:CCGGGCAGGGAATTGTTTGAGTCTTCTCGAGAAGACTCAAACAATTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1959s1c1
Sequence:CCGGGCTTCCATTACGATGCACAAACTCGAGTTTGTGCATCGTAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017778.2-2565s21c1
Sequence:CCGGCAATCATCATTATTGGCATTTCTCGAGAAATGCCAATAATGATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017778.2-768s21c1
Sequence:CCGGACCAAATACCAGTCATATAATCTCGAGATTATATGACTGGTATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017778.2-2617s21c1
Sequence:CCGGCAATTGCTTTAACAGTCAAATCTCGAGATTTGACTGTTAAAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017778
WHSC1L1 MISSION shRNA Lentiviral Transduction Particles
Wolf-Hirschhorn syndrome candidate 1-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1500s1c1
Sequence:CCGGCGAGAGTATAAAGGTCATAAACTCGAGTTTATGACCTTTATACTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-738s1c1
Sequence:CCGGCCATCATCAATCAGTGTGTATCTCGAGATACACACTGATTGATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1434s1c1
Sequence:CCGGCGAGAATATCATGTCCAGTTTCTCGAGAAACTGGACATGATATTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1009s1c1
Sequence:CCGGGCAGGGAATTGTTTGAGTCTTCTCGAGAAGACTCAAACAATTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017778.2-1959s1c1
Sequence:CCGGGCTTCCATTACGATGCACAAACTCGAGTTTGTGCATCGTAATGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017778.2-2565s21c1
Sequence:CCGGCAATCATCATTATTGGCATTTCTCGAGAAATGCCAATAATGATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017778.2-768s21c1
Sequence:CCGGACCAAATACCAGTCATATAATCTCGAGATTATATGACTGGTATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017778.2-2617s21c1
Sequence:CCGGCAATTGCTTTAACAGTCAAATCTCGAGATTTGACTGTTAAAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001735
VALIDATED
WHSC1L1 MISSION shRNA Bacterial Glycerol Stock
Wolf-Hirschhorn syndrome candidate 1-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001735.1-2831s21c1
Sequence:CCGGCTGTATACATTGCAATCATTACTCGAGTAATGATTGCAATGTATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001735.1-1661s21c1
Sequence:CCGGAGAGTAGAGCAGTACACTTTCCTCGAGGAAAGTGTACTGCTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001735.1-791s21c1
Sequence:CCGGTTTAGCCCTACTGACTATTACCTCGAGGTAATAGTCAGTAGGGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001735.1-725s21c1
Sequence:CCGGACCAAATACCCGCCATATAATCTCGAGATTATATGGCGGGTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001735.1-525s21c1
Sequence:CCGGAGCAACCACCTCAACTCATTGCTCGAGCAATGAGTTGAGGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001735
VALIDATED
WHSC1L1 MISSION shRNA shRNA Plasmid DNA
Wolf-Hirschhorn syndrome candidate 1-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001735.1-2831s21c1
Sequence:CCGGCTGTATACATTGCAATCATTACTCGAGTAATGATTGCAATGTATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001735.1-1661s21c1
Sequence:CCGGAGAGTAGAGCAGTACACTTTCCTCGAGGAAAGTGTACTGCTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001735.1-791s21c1
Sequence:CCGGTTTAGCCCTACTGACTATTACCTCGAGGTAATAGTCAGTAGGGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001735.1-725s21c1
Sequence:CCGGACCAAATACCCGCCATATAATCTCGAGATTATATGGCGGGTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001735.1-525s21c1
Sequence:CCGGAGCAACCACCTCAACTCATTGCTCGAGCAATGAGTTGAGGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001735
VALIDATED
WHSC1L1 MISSION shRNA Lentiviral Transduction Particles
Wolf-Hirschhorn syndrome candidate 1-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001735.1-2831s21c1
Sequence:CCGGCTGTATACATTGCAATCATTACTCGAGTAATGATTGCAATGTATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001735.1-1661s21c1
Sequence:CCGGAGAGTAGAGCAGTACACTTTCCTCGAGGAAAGTGTACTGCTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001735.1-791s21c1
Sequence:CCGGTTTAGCCCTACTGACTATTACCTCGAGGTAATAGTCAGTAGGGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001001735.1-725s21c1
Sequence:CCGGACCAAATACCCGCCATATAATCTCGAGATTATATGGCGGGTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001735.1-525s21c1
Sequence:CCGGAGCAACCACCTCAACTCATTGCTCGAGCAATGAGTTGAGGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks