EMAIL THIS PAGE TO A FRIEND

WIBG

within bgcn homolog (Drosophila)

Synonyms: PYM
UniProtKB ID: Q9BRP8, B6ZDM5, Q8IXJ8, Q8N8E7
Gene ID:
Mouse(78428) within bgcn homolog (Drosophila)
Rat(366790) within bgcn homolog (Drosophila)
fruit fly(37780) within bgcn
Zebrafish(393566) within bgcn homolog (Drosophila)
dog(481101) within bgcn homolog (Drosophila)
domestic cat(101092276) within bgcn homolog (Drosophila)
chicken(100858240) within bgcn homolog (Drosophila)
cow(787259) within bgcn homolog (Drosophila)
domestic guinea pig(100715628) within bgcn homolog (Drosophila)
naked mole-rat(101726469) within bgcn homolog (Drosophila)
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032345 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032345 Rosetta Predictions human pricing
NM_001108986 Rosetta Predictions rat pricing
NM_030100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115699 predicted 679
2 SASI_Hs01_00115700 predicted 466
3 SASI_Hs01_00115701 predicted 783
4 SASI_Hs01_00115702 predicted 784
5 SASI_Hs01_00115703 predicted 397
6 SASI_Hs01_00115704 predicted 329
7 SASI_Hs01_00115705 predicted 231
8 SASI_Hs01_00115706 predicted 901
9 SASI_Hs01_00115707 predicted 409
10 SASI_Hs02_00359732 predicted 227
11 SASI_Hs01_00115708 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244044 predicted 584
2 SASI_Rn02_00244045 predicted 872
3 SASI_Rn02_00244046 predicted 379
4 SASI_Rn02_00244047 predicted 309
5 SASI_Rn02_00244048 predicted 828
6 SASI_Rn02_00244049 predicted 296
7 SASI_Rn02_00244050 predicted 665
8 SASI_Rn02_00244051 predicted 825
9 SASI_Rn02_00244052 predicted 659
10 SASI_Rn02_00244053 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033347 predicted 244
2 SASI_Mm01_00033348 predicted 313
3 SASI_Mm01_00033349 predicted 322
4 SASI_Mm01_00033350 predicted 239
5 SASI_Mm01_00033351 predicted 356
6 SASI_Mm01_00033352 predicted 349
7 SASI_Mm01_00033353 predicted 354
8 SASI_Mm01_00033354 predicted 235
9 SASI_Mm01_00033355 predicted 250
10 SASI_Mm01_00033356 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032345
VALIDATED
WIBG MISSION shRNA Bacterial Glycerol Stock
within bgcn homolog (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032345.1-407s1c1
Sequence:CCGGGACAGCCAAACGTAACCTGAACTCGAGTTCAGGTTACGTTTGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032345.1-485s1c1
Sequence:CCGGGACTCTTGATAAGGTGTCCCTCTCGAGAGGGACACCTTATCAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-1005s1c1
Sequence:CCGGCAGGTACCTTTGCTGCTGATTCTCGAGAATCAGCAGCAAAGGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-476s1c1
Sequence:CCGGCTTGAGCAGGACTCTTGATAACTCGAGTTATCAAGAGTCCTGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-738s1c1
Sequence:CCGGGAGTTAGAGGACTTGGAGTTACTCGAGTAACTCCAAGTCCTCTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032345.1-593s1c1
Sequence:CCGGCACTGAGAAAGCCAAGAAGATCTCGAGATCTTCTTGGCTTTCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032345.1-418s1c1
Sequence:CCGGGTAACCTGAAGCGAAAGGAGACTCGAGTCTCCTTTCGCTTCAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032345.1-412s1c1
Sequence:CCGGCCAAACGTAACCTGAAGCGAACTCGAGTTCGCTTCAGGTTACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-688s1c1
Sequence:CCGGCCAGCAAAGAGCAGCTAGAAACTCGAGTTTCTAGCTGCTCTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032345
VALIDATED
WIBG MISSION shRNA shRNA Plasmid DNA
within bgcn homolog (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032345.1-407s1c1
Sequence:CCGGGACAGCCAAACGTAACCTGAACTCGAGTTCAGGTTACGTTTGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032345.1-485s1c1
Sequence:CCGGGACTCTTGATAAGGTGTCCCTCTCGAGAGGGACACCTTATCAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-1005s1c1
Sequence:CCGGCAGGTACCTTTGCTGCTGATTCTCGAGAATCAGCAGCAAAGGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-476s1c1
Sequence:CCGGCTTGAGCAGGACTCTTGATAACTCGAGTTATCAAGAGTCCTGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-738s1c1
Sequence:CCGGGAGTTAGAGGACTTGGAGTTACTCGAGTAACTCCAAGTCCTCTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032345.1-593s1c1
Sequence:CCGGCACTGAGAAAGCCAAGAAGATCTCGAGATCTTCTTGGCTTTCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032345.1-418s1c1
Sequence:CCGGGTAACCTGAAGCGAAAGGAGACTCGAGTCTCCTTTCGCTTCAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032345.1-412s1c1
Sequence:CCGGCCAAACGTAACCTGAAGCGAACTCGAGTTCGCTTCAGGTTACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-688s1c1
Sequence:CCGGCCAGCAAAGAGCAGCTAGAAACTCGAGTTTCTAGCTGCTCTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032345
VALIDATED
WIBG MISSION shRNA Lentiviral Transduction Particles
within bgcn homolog (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032345.1-407s1c1
Sequence:CCGGGACAGCCAAACGTAACCTGAACTCGAGTTCAGGTTACGTTTGGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032345.1-485s1c1
Sequence:CCGGGACTCTTGATAAGGTGTCCCTCTCGAGAGGGACACCTTATCAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137546    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-1005s1c1
Sequence:CCGGCAGGTACCTTTGCTGCTGATTCTCGAGAATCAGCAGCAAAGGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-476s1c1
Sequence:CCGGCTTGAGCAGGACTCTTGATAACTCGAGTTATCAAGAGTCCTGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-738s1c1
Sequence:CCGGGAGTTAGAGGACTTGGAGTTACTCGAGTAACTCCAAGTCCTCTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032345.1-593s1c1
Sequence:CCGGCACTGAGAAAGCCAAGAAGATCTCGAGATCTTCTTGGCTTTCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032345.1-418s1c1
Sequence:CCGGGTAACCTGAAGCGAAAGGAGACTCGAGTCTCCTTTCGCTTCAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032345.1-412s1c1
Sequence:CCGGCCAAACGTAACCTGAAGCGAACTCGAGTTCGCTTCAGGTTACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_032345.1-688s1c1
Sequence:CCGGCCAGCAAAGAGCAGCTAGAAACTCGAGTTTCTAGCTGCTCTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030100
WIBG MISSION shRNA Bacterial Glycerol Stock
within bgcn homolog (Drosophila)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030100.2-453s1c1
Sequence:CCGGGAAGATCAAGAACCTGAGGAACTCGAGTTCCTCAGGTTCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-261s1c1
Sequence:CCGGCAAACGAAACCTGAAGCGGAACTCGAGTTCCGCTTCAGGTTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-35s1c1
Sequence:CCGGCAGGCAAGTACATTGCCTCAACTCGAGTTGAGGCAATGTACTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-438s1c1
Sequence:CCGGCACAGAGAAAGCCAAGAAGATCTCGAGATCTTCTTGGCTTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-39s1c1
Sequence:CCGGCAAGTACATTGCCTCAACACACTCGAGTGTGTTGAGGCAATGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030100.2-444s1c1
Sequence:CCGGGAAAGCCAAGAAGATCAAGAACTCGAGTTCTTGATCTTCTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030100
WIBG MISSION shRNA shRNA Plasmid DNA
within bgcn homolog (Drosophila)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030100.2-453s1c1
Sequence:CCGGGAAGATCAAGAACCTGAGGAACTCGAGTTCCTCAGGTTCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-261s1c1
Sequence:CCGGCAAACGAAACCTGAAGCGGAACTCGAGTTCCGCTTCAGGTTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-35s1c1
Sequence:CCGGCAGGCAAGTACATTGCCTCAACTCGAGTTGAGGCAATGTACTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-438s1c1
Sequence:CCGGCACAGAGAAAGCCAAGAAGATCTCGAGATCTTCTTGGCTTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-39s1c1
Sequence:CCGGCAAGTACATTGCCTCAACACACTCGAGTGTGTTGAGGCAATGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030100.2-444s1c1
Sequence:CCGGGAAAGCCAAGAAGATCAAGAACTCGAGTTCTTGATCTTCTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030100
WIBG MISSION shRNA Lentiviral Transduction Particles
within bgcn homolog (Drosophila)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030100.2-453s1c1
Sequence:CCGGGAAGATCAAGAACCTGAGGAACTCGAGTTCCTCAGGTTCTTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-261s1c1
Sequence:CCGGCAAACGAAACCTGAAGCGGAACTCGAGTTCCGCTTCAGGTTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-35s1c1
Sequence:CCGGCAGGCAAGTACATTGCCTCAACTCGAGTTGAGGCAATGTACTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-438s1c1
Sequence:CCGGCACAGAGAAAGCCAAGAAGATCTCGAGATCTTCTTGGCTTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030100.2-39s1c1
Sequence:CCGGCAAGTACATTGCCTCAACACACTCGAGTGTGTTGAGGCAATGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030100.2-444s1c1
Sequence:CCGGGAAAGCCAAGAAGATCAAGAACTCGAGTTCTTGATCTTCTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks