EMAIL THIS PAGE TO A FRIEND

WIF1

WNT inhibitory factor 1

Synonyms: WIF-1
UniProtKB ID: Q9Y5W5, Q6UXI1, Q8WVG4
Gene ID:
Human(11197) Summary: The protein encoded by this gene functions to inhibit WNT proteins, which are extracellular signaling molecules that play a role in embryonic development. This protein contains a WNT inhibitory factor (WIF) domain and five epidermal growth factor (EGF)-like domains, and is thought to be involved in mesoderm segmentation. This gene functions as a tumor suppressor gene, and has been found to be epigenetically silenced in various cancers. [provided by RefSeq, Jun 2010]
Mouse(24117) Wnt inhibitory factor 1
Rat(114557) Wnt inhibitory factor 1
naked mole-rat(101708267) WNT inhibitory factor 1
domestic guinea pig(100736242) WNT inhibitory factor 1
cow(533672) WNT inhibitory factor 1
sheep(101109259) WNT inhibitory factor 1
Zebrafish(30476) wnt inhibitory factor 1
chicken(417831) WNT inhibitory factor 1
dog(481148) WNT inhibitory factor 1
domestic cat(101088855) WNT inhibitory factor 1
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0752 Human WIF1 / Wnt Inhibitory Factor 1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007191 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007191 Rosetta Predictions human pricing
NM_053738 Rosetta Predictions rat pricing
NM_011915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239412 predicted 278
2 SASI_Hs01_00239413 predicted 589
3 SASI_Hs02_00343162 predicted 901
4 SASI_Hs01_00239415 predicted 524
5 SASI_Hs01_00239416 predicted 388
6 SASI_Hs01_00239417 predicted 1331
7 SASI_Hs01_00239418 predicted 433
8 SASI_Hs01_00239419 predicted 381
9 SASI_Hs01_00239421 predicted 604
10 SASI_Hs02_00343163 predicted 631
11 SASI_Hs01_00239414 predicted 353
12 SASI_Hs01_00239420 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093353 predicted 433
2 SASI_Rn01_00093354 predicted 551
3 SASI_Rn01_00093355 predicted 445
4 SASI_Rn01_00093357 predicted 594
5 SASI_Rn01_00093358 predicted 411
6 SASI_Rn01_00093359 predicted 1157
7 SASI_Rn01_00093360 predicted 688
8 SASI_Rn01_00093362 predicted 860
9 SASI_Rn02_00266519 predicted 1372
10 SASI_Rn02_00266520 predicted 540
11 SASI_Rn01_00093356 predicted 544
12 SASI_Rn01_00093361 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099243 predicted 986
2 SASI_Mm01_00099244 predicted 563
3 SASI_Mm01_00099245 predicted 237
4 SASI_Mm01_00099246 predicted 616
5 SASI_Mm01_00099247 predicted 355
6 SASI_Mm01_00099248 predicted 983
7 SASI_Mm01_00099249 predicted 495
8 SASI_Mm01_00099250 predicted 1212
9 SASI_Mm01_00099251 predicted 399
10 SASI_Mm01_00099252 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011915
WIF1 MISSION shRNA Bacterial Glycerol Stock
WNT inhibitory factor 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011915.1-1660s1c1
Sequence:CCGGGCAGCGTTTAAGCTACAGTATCTCGAGATACTGTAGCTTAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-1109s1c1
Sequence:CCGGGCACGGCAGACACTGCAATAACTCGAGTTATTGCAGTGTCTGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-246s1c1
Sequence:CCGGGCTAGAGTGCTCATAGGATTTCTCGAGAAATCCTATGAGCACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-344s1c1
Sequence:CCGGGCCAGCCATTCCTGTCAATATCTCGAGATATTGACAGGAATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-812s1c1
Sequence:CCGGCCCTGGATTCTACGGTGTCAACTCGAGTTGACACCGTAGAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011915.2-1448s21c1
Sequence:CCGGGGGATCCACCTGAATCCAATTCTCGAGAATTGGATTCAGGTGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011915.2-1659s21c1
Sequence:CCGGGTGTCTAGCATGATGGTATAGCTCGAGCTATACCATCATGCTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011915
WIF1 MISSION shRNA shRNA Plasmid DNA
WNT inhibitory factor 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011915.1-1660s1c1
Sequence:CCGGGCAGCGTTTAAGCTACAGTATCTCGAGATACTGTAGCTTAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-1109s1c1
Sequence:CCGGGCACGGCAGACACTGCAATAACTCGAGTTATTGCAGTGTCTGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-246s1c1
Sequence:CCGGGCTAGAGTGCTCATAGGATTTCTCGAGAAATCCTATGAGCACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-344s1c1
Sequence:CCGGGCCAGCCATTCCTGTCAATATCTCGAGATATTGACAGGAATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-812s1c1
Sequence:CCGGCCCTGGATTCTACGGTGTCAACTCGAGTTGACACCGTAGAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011915.2-1448s21c1
Sequence:CCGGGGGATCCACCTGAATCCAATTCTCGAGAATTGGATTCAGGTGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011915.2-1659s21c1
Sequence:CCGGGTGTCTAGCATGATGGTATAGCTCGAGCTATACCATCATGCTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011915
WIF1 MISSION shRNA Lentiviral Transduction Particles
WNT inhibitory factor 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011915.1-1660s1c1
Sequence:CCGGGCAGCGTTTAAGCTACAGTATCTCGAGATACTGTAGCTTAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-1109s1c1
Sequence:CCGGGCACGGCAGACACTGCAATAACTCGAGTTATTGCAGTGTCTGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-246s1c1
Sequence:CCGGGCTAGAGTGCTCATAGGATTTCTCGAGAAATCCTATGAGCACTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-344s1c1
Sequence:CCGGGCCAGCCATTCCTGTCAATATCTCGAGATATTGACAGGAATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011915.1-812s1c1
Sequence:CCGGCCCTGGATTCTACGGTGTCAACTCGAGTTGACACCGTAGAATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011915.2-1448s21c1
Sequence:CCGGGGGATCCACCTGAATCCAATTCTCGAGAATTGGATTCAGGTGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011915.2-1659s21c1
Sequence:CCGGGTGTCTAGCATGATGGTATAGCTCGAGCTATACCATCATGCTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007191
WIF1 MISSION shRNA Bacterial Glycerol Stock
WNT inhibitory factor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-960s1c1
Sequence:CCGGCCTGTCGAAATGGAGGTAAATCTCGAGATTTACCTCCATTTCGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-251s1c1
Sequence:CCGGGCAAGAGTACTCATAGGATTTCTCGAGAAATCCTATGAGTACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-563s1c1
Sequence:CCGGGCATTTGAAGTGGATGTGATTCTCGAGAATCACATCCACTTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-349s1c1
Sequence:CCGGGCCAGCTATTCCTGTCAATATCTCGAGATATTGACAGGAATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-767s1c1
Sequence:CCGGCGATGTATGAATGGTGGACTTCTCGAGAAGTCCACCATTCATACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007191.3-1413s21c1
Sequence:CCGGTAAATCACTGAGCTGATATTTCTCGAGAAATATCAGCTCAGTGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007191.3-1520s21c1
Sequence:CCGGATGTCAATTGATCAGGTTAAACTCGAGTTTAACCTGATCAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007191
WIF1 MISSION shRNA shRNA Plasmid DNA
WNT inhibitory factor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-960s1c1
Sequence:CCGGCCTGTCGAAATGGAGGTAAATCTCGAGATTTACCTCCATTTCGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-251s1c1
Sequence:CCGGGCAAGAGTACTCATAGGATTTCTCGAGAAATCCTATGAGTACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-563s1c1
Sequence:CCGGGCATTTGAAGTGGATGTGATTCTCGAGAATCACATCCACTTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-349s1c1
Sequence:CCGGGCCAGCTATTCCTGTCAATATCTCGAGATATTGACAGGAATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-767s1c1
Sequence:CCGGCGATGTATGAATGGTGGACTTCTCGAGAAGTCCACCATTCATACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007191.3-1413s21c1
Sequence:CCGGTAAATCACTGAGCTGATATTTCTCGAGAAATATCAGCTCAGTGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007191.3-1520s21c1
Sequence:CCGGATGTCAATTGATCAGGTTAAACTCGAGTTTAACCTGATCAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007191
WIF1 MISSION shRNA Lentiviral Transduction Particles
WNT inhibitory factor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-960s1c1
Sequence:CCGGCCTGTCGAAATGGAGGTAAATCTCGAGATTTACCTCCATTTCGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-251s1c1
Sequence:CCGGGCAAGAGTACTCATAGGATTTCTCGAGAAATCCTATGAGTACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-563s1c1
Sequence:CCGGGCATTTGAAGTGGATGTGATTCTCGAGAATCACATCCACTTCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-349s1c1
Sequence:CCGGGCCAGCTATTCCTGTCAATATCTCGAGATATTGACAGGAATAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007191.2-767s1c1
Sequence:CCGGCGATGTATGAATGGTGGACTTCTCGAGAAGTCCACCATTCATACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007191.3-1413s21c1
Sequence:CCGGTAAATCACTGAGCTGATATTTCTCGAGAAATATCAGCTCAGTGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007191.3-1520s21c1
Sequence:CCGGATGTCAATTGATCAGGTTAAACTCGAGTTTAACCTGATCAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks