EMAIL THIS PAGE TO A FRIEND

WIPF1

WAS/WASL interacting protein family, member 1

Synonyms: PRPL-2 WASPIP WIP
Gene ID:
Human(7456) Summary: This gene encodes a protein that plays an important role in the organization of the actin cytoskeleton. The encoded protein binds to a region of Wiskott-Aldrich syndrome protein that is frequently mutated in Wiskott-Aldrich syndrome, an X-linked recessive disorder. Impairment of the interaction between these two proteins may contribute to the disease. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(215280) WAS/WASL interacting protein family, member 1
Rat(117538) WAS/WASL interacting protein family, member 1
Zebrafish(100151491) WAS/WASL interacting protein family, member 1
dog(488409) WAS/WASL interacting protein family, member 1
domestic cat(101096587) WAS/WASL interacting protein family, member 1
chicken(424143) WAS/WASL interacting protein family, member 1
cow(540304) WAS/WASL interacting protein family, member 1
sheep(101110390) WAS/WASL interacting protein family, member 1
domestic guinea pig(100726342) WAS/WASL interacting protein family, member 1
naked mole-rat(101714430) WAS/WASL interacting protein family, member 1
Gene Class: Cytoskeleton
218 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003387 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077269 Rosetta Predictions human pricing
NM_003387 Rosetta Predictions human pricing
NM_057192 Rosetta Predictions rat pricing
NM_153138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312354 predicted 1860
2 SASI_Hs02_00312355 predicted 1477
3 SASI_Hs02_00312356 predicted 1672
4 SASI_Hs02_00312357 predicted 1451
5 SASI_Hs02_00312358 predicted 1521
6 SASI_Hs02_00312359 predicted 1864
7 SASI_Hs02_00312360 predicted 1124
8 SASI_Hs02_00312361 predicted 1165
9 SASI_Hs02_00312362 predicted 1128
10 SASI_Hs02_00312363 predicted 1869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118228 predicted 1790
2 SASI_Hs01_00118229 predicted 1418
3 SASI_Hs02_00335557 predicted 1607
4 SASI_Hs01_00118230 predicted 1384
5 SASI_Hs01_00118231 predicted 1453
6 SASI_Hs01_00118232 predicted 1802
7 SASI_Hs01_00118233 predicted 1060
8 SASI_Hs01_00118234 predicted 1107
9 SASI_Hs01_00118235 predicted 1068
10 SASI_Hs01_00118236 predicted 1806
11 SASI_Hs01_00118237 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097837 predicted 1785
2 SASI_Rn01_00097838 predicted 199
3 SASI_Rn01_00097839 predicted 1548
4 SASI_Rn01_00097840 predicted 1473
5 SASI_Rn01_00097841 predicted 217
6 SASI_Rn01_00097842 predicted 1473
7 SASI_Rn01_00097843 predicted 329
8 SASI_Rn01_00097844 predicted 1784
9 SASI_Rn01_00097845 predicted 1509
10 SASI_Rn01_00097846 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022582 predicted 1423
2 SASI_Mm01_00022583 predicted 1441
3 SASI_Mm01_00022584 predicted 1964
4 SASI_Mm01_00022585 predicted 1453
5 SASI_Mm01_00022586 predicted 1994
6 SASI_Mm01_00022587 predicted 1407
7 SASI_Mm01_00022588 predicted 1992
8 SASI_Mm01_00022589 predicted 910
9 SASI_Mm01_00022590 predicted 1389
10 SASI_Mm01_00022591 predicted 1420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153138
WIPF1 MISSION shRNA Bacterial Glycerol Stock
WAS/WASL interacting protein family, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153138.3-1984s21c1
Sequence:CCGGGGTTACAGAACGTCCGATCTTCTCGAGAAGATCGGACGTTCTGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153138.3-465s21c1
Sequence:CCGGACCGCCAACAGGGATAATGATCTCGAGATCATTATCCCTGTTGGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153138.3-1543s21c1
Sequence:CCGGGCCGAAGTGGATCCAACAGAACTCGAGTTCTGTTGGATCCACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153138.3-1802s21c1
Sequence:CCGGTCCTGAGCTATTGCTTGTATCCTCGAGGATACAAGCAATAGCTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153138.3-1064s21c1
Sequence:CCGGTCCAGCTTCCAACGACGAGATCTCGAGATCTCGTCGTTGGAAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153138.3-1618s21c1
Sequence:CCGGCGTTCTACCCAAGCTCCAAAGCTCGAGCTTTGGAGCTTGGGTAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153138.2-1389s1c1
Sequence:CCGGCCCTCCACATCAGTTCGAAATCTCGAGATTTCGAACTGATGTGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153138.2-1497s1c1
Sequence:CCGGGTACCGACAACCAAGACGTATCTCGAGATACGTCTTGGTTGTCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153138.2-1777s1c1
Sequence:CCGGGCCTAGCTGTTTATGTTGTATCTCGAGATACAACATAAACAGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153138.2-1443s1c1
Sequence:CCGGGAAAGCAGATTCTACTTCCATCTCGAGATGGAAGTAGAATCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153138
WIPF1 MISSION shRNA shRNA Plasmid DNA
WAS/WASL interacting protein family, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153138.3-1984s21c1
Sequence:CCGGGGTTACAGAACGTCCGATCTTCTCGAGAAGATCGGACGTTCTGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153138.3-465s21c1
Sequence:CCGGACCGCCAACAGGGATAATGATCTCGAGATCATTATCCCTGTTGGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153138.3-1543s21c1
Sequence:CCGGGCCGAAGTGGATCCAACAGAACTCGAGTTCTGTTGGATCCACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153138.3-1802s21c1
Sequence:CCGGTCCTGAGCTATTGCTTGTATCCTCGAGGATACAAGCAATAGCTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153138.3-1064s21c1
Sequence:CCGGTCCAGCTTCCAACGACGAGATCTCGAGATCTCGTCGTTGGAAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153138.3-1618s21c1
Sequence:CCGGCGTTCTACCCAAGCTCCAAAGCTCGAGCTTTGGAGCTTGGGTAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153138.2-1389s1c1
Sequence:CCGGCCCTCCACATCAGTTCGAAATCTCGAGATTTCGAACTGATGTGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153138.2-1497s1c1
Sequence:CCGGGTACCGACAACCAAGACGTATCTCGAGATACGTCTTGGTTGTCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153138.2-1777s1c1
Sequence:CCGGGCCTAGCTGTTTATGTTGTATCTCGAGATACAACATAAACAGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153138.2-1443s1c1
Sequence:CCGGGAAAGCAGATTCTACTTCCATCTCGAGATGGAAGTAGAATCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153138
WIPF1 MISSION shRNA Lentiviral Transduction Particles
WAS/WASL interacting protein family, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153138.3-1984s21c1
Sequence:CCGGGGTTACAGAACGTCCGATCTTCTCGAGAAGATCGGACGTTCTGTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153138.3-465s21c1
Sequence:CCGGACCGCCAACAGGGATAATGATCTCGAGATCATTATCCCTGTTGGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153138.3-1543s21c1
Sequence:CCGGGCCGAAGTGGATCCAACAGAACTCGAGTTCTGTTGGATCCACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153138.3-1802s21c1
Sequence:CCGGTCCTGAGCTATTGCTTGTATCCTCGAGGATACAAGCAATAGCTCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153138.3-1064s21c1
Sequence:CCGGTCCAGCTTCCAACGACGAGATCTCGAGATCTCGTCGTTGGAAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153138.3-1618s21c1
Sequence:CCGGCGTTCTACCCAAGCTCCAAAGCTCGAGCTTTGGAGCTTGGGTAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153138.2-1389s1c1
Sequence:CCGGCCCTCCACATCAGTTCGAAATCTCGAGATTTCGAACTGATGTGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153138.2-1497s1c1
Sequence:CCGGGTACCGACAACCAAGACGTATCTCGAGATACGTCTTGGTTGTCGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153138.2-1777s1c1
Sequence:CCGGGCCTAGCTGTTTATGTTGTATCTCGAGATACAACATAAACAGCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153138.2-1443s1c1
Sequence:CCGGGAAAGCAGATTCTACTTCCATCTCGAGATGGAAGTAGAATCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003387
VALIDATED
WIPF1 MISSION shRNA Bacterial Glycerol Stock
WAS/WASL interacting protein family, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003387.4-1458s21c1
Sequence:CCGGGATTCTACTTCCATCCGATTTCTCGAGAAATCGGATGGAAGTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003387.4-1531s21c1
Sequence:CCGGCAAACTGGCAAGAAACGAAAGCTCGAGCTTTCGTTTCTTGCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003387.4-1757s21c1
Sequence:CCGGGGGTGGGAATCGGTAAGAAATCTCGAGATTTCTTACCGATTCCCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-1430s1c1
Sequence:CCGGCCATGTGAAGATGAGTGGGAACTCGAGTTCCCACTCATCTTCACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-1388s1c1
Sequence:CCGGCCTCCACCATCAACATCTATTCTCGAGAATAGATGTTGATGGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-676s1c1
Sequence:CCGGCATTCAATCAAGTCCGCACAACTCGAGTTGTGCGGACTTGATTGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-266s1c1
Sequence:CCGGCCAATACTGGACAAACCTAAACTCGAGTTTAGGTTTGTCCAGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003387
VALIDATED
WIPF1 MISSION shRNA shRNA Plasmid DNA
WAS/WASL interacting protein family, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003387.4-1458s21c1
Sequence:CCGGGATTCTACTTCCATCCGATTTCTCGAGAAATCGGATGGAAGTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003387.4-1531s21c1
Sequence:CCGGCAAACTGGCAAGAAACGAAAGCTCGAGCTTTCGTTTCTTGCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003387.4-1757s21c1
Sequence:CCGGGGGTGGGAATCGGTAAGAAATCTCGAGATTTCTTACCGATTCCCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-1430s1c1
Sequence:CCGGCCATGTGAAGATGAGTGGGAACTCGAGTTCCCACTCATCTTCACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-1388s1c1
Sequence:CCGGCCTCCACCATCAACATCTATTCTCGAGAATAGATGTTGATGGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-676s1c1
Sequence:CCGGCATTCAATCAAGTCCGCACAACTCGAGTTGTGCGGACTTGATTGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-266s1c1
Sequence:CCGGCCAATACTGGACAAACCTAAACTCGAGTTTAGGTTTGTCCAGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003387
VALIDATED
WIPF1 MISSION shRNA Lentiviral Transduction Particles
WAS/WASL interacting protein family, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003387.4-1458s21c1
Sequence:CCGGGATTCTACTTCCATCCGATTTCTCGAGAAATCGGATGGAAGTAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003387.4-1531s21c1
Sequence:CCGGCAAACTGGCAAGAAACGAAAGCTCGAGCTTTCGTTTCTTGCCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003387.4-1757s21c1
Sequence:CCGGGGGTGGGAATCGGTAAGAAATCTCGAGATTTCTTACCGATTCCCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-1430s1c1
Sequence:CCGGCCATGTGAAGATGAGTGGGAACTCGAGTTCCCACTCATCTTCACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-1388s1c1
Sequence:CCGGCCTCCACCATCAACATCTATTCTCGAGAATAGATGTTGATGGTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-676s1c1
Sequence:CCGGCATTCAATCAAGTCCGCACAACTCGAGTTGTGCGGACTTGATTGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003387.3-266s1c1
Sequence:CCGGCCAATACTGGACAAACCTAAACTCGAGTTTAGGTTTGTCCAGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks