EMAIL THIS PAGE TO A FRIEND

WIPF2

WAS/WASL interacting protein family, member 2

Synonyms: WICH WIRE
UniProtKB ID: Q8TF74, A8K0L3, Q658J8, Q71RE1, Q8TE44
Gene ID:
Human(147179) Summary: This gene encodes a WASP interacting protein (WIP)-related protein. It has been shown that this protein has a role in the WASP-mediated organization of the actin cytoskeleton and that this protein is a potential link between the activated platelet-derived growth factor receptor and the actin polymerization machinery. [provided by RefSeq, Jul 2008]
Mouse(68524) WAS/WASL interacting protein family, member 2
Rat(360620) WAS/WASL interacting protein family, member 2
naked mole-rat(101725343) WAS/WASL interacting protein family, member 2
domestic guinea pig(100727930) WAS/WASL interacting protein family, member 2
cow(616849) WAS/WASL interacting protein family, member 2
sheep(101107294) WAS/WASL interacting protein family, member 2
chicken(771898) WAS/WASL interacting protein family, member 2
domestic cat(101082534) WAS/WASL interacting protein family, member 2
dog(608186) WAS/WASL interacting protein family, member 2
Gene Class: Cytoskeleton
262 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_197940 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197940 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197940 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133264 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056751 MISSION® esiRNA esiRNA human WIPF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133264 Rosetta Predictions human pricing
XM_001081411 Rosetta Predictions rat pricing
XM_340895 Rosetta Predictions rat pricing
NM_197940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362965 predicted 1493
2 SASI_Hs02_00362966 predicted 1402
3 SASI_Hs02_00362967 predicted 379
4 SASI_Hs01_00035278 predicted 1728
5 SASI_Hs01_00035279 predicted 1070
6 SASI_Hs01_00035280 predicted 1650
7 SASI_Hs01_00035281 predicted 392
8 SASI_Hs01_00035282 predicted 1656
9 SASI_Hs01_00035283 predicted 553
10 SASI_Hs01_00035284 predicted 1381
11 SASI_Hs01_00035275 predicted 1659
12 SASI_Hs01_00035276 predicted 1825
13 SASI_Hs01_00035277 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371768 predicted 623
2 SASI_Rn02_00371769 predicted 625
3 SASI_Rn02_00371770 predicted 1202
4 SASI_Rn02_00371771 predicted 1195
5 SASI_Rn02_00371772 predicted 929
6 SASI_Rn02_00371773 predicted 973
7 SASI_Rn02_00371774 predicted 1483
8 SASI_Rn02_00371775 predicted 1284
9 SASI_Rn02_00371776 predicted 1145
10 SASI_Rn02_00371777 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392080 predicted 1412
2 SASI_Rn02_00392081 predicted 1404
3 SASI_Rn02_00392082 predicted 1487
4 SASI_Rn02_00392083 predicted 1159
5 SASI_Rn02_00392084 predicted 1141
6 SASI_Rn02_00392085 predicted 1177
7 SASI_Rn02_00392086 predicted 1689
8 SASI_Rn02_00392087 predicted 1493
9 SASI_Rn02_00392088 predicted 1345
10 SASI_Rn02_00392089 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033720 predicted 995
2 SASI_Mm01_00033721 predicted 1942
3 SASI_Mm01_00033722 predicted 1978
4 SASI_Mm01_00033723 predicted 1652
5 SASI_Mm01_00033724 predicted 777
6 SASI_Mm01_00033726 predicted 1793
7 SASI_Mm02_00350651 predicted 614
8 SASI_Mm01_00033727 predicted 1511
9 SASI_Mm01_00033728 predicted 457
10 SASI_Mm02_00350652 predicted 1620
11 SASI_Mm01_00033725 predicted 1853
12 SASI_Mm01_00033729 predicted 1530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197940
WIPF2 MISSION shRNA Bacterial Glycerol Stock
WAS/WASL interacting protein family, member 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197940.1-1000s1c1
Sequence:CCGGCACAATTCTTTGCATAGGAAACTCGAGTTTCCTATGCAAAGAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197940.1-4195s1c1
Sequence:CCGGGCTATTACTTAGTCCCTTTAACTCGAGTTAAAGGGACTAAGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197940.1-763s1c1
Sequence:CCGGCAAGCCTACAACAGGGAGAAACTCGAGTTTCTCCCTGTTGTAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197940.1-868s1c1
Sequence:CCGGCCTGTGAACATCAGAACAGGACTCGAGTCCTGTTCTGATGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197940
WIPF2 MISSION shRNA shRNA Plasmid DNA
WAS/WASL interacting protein family, member 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197940.1-1000s1c1
Sequence:CCGGCACAATTCTTTGCATAGGAAACTCGAGTTTCCTATGCAAAGAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197940.1-4195s1c1
Sequence:CCGGGCTATTACTTAGTCCCTTTAACTCGAGTTAAAGGGACTAAGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197940.1-763s1c1
Sequence:CCGGCAAGCCTACAACAGGGAGAAACTCGAGTTTCTCCCTGTTGTAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197940.1-868s1c1
Sequence:CCGGCCTGTGAACATCAGAACAGGACTCGAGTCCTGTTCTGATGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197940
WIPF2 MISSION shRNA Lentiviral Transduction Particles
WAS/WASL interacting protein family, member 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197940.1-1000s1c1
Sequence:CCGGCACAATTCTTTGCATAGGAAACTCGAGTTTCCTATGCAAAGAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197940.1-4195s1c1
Sequence:CCGGGCTATTACTTAGTCCCTTTAACTCGAGTTAAAGGGACTAAGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197940.1-763s1c1
Sequence:CCGGCAAGCCTACAACAGGGAGAAACTCGAGTTTCTCCCTGTTGTAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197940.1-868s1c1
Sequence:CCGGCCTGTGAACATCAGAACAGGACTCGAGTCCTGTTCTGATGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133264
VALIDATED
WIPF2 MISSION shRNA Bacterial Glycerol Stock
WAS/WASL interacting protein family, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-1252s1c1
Sequence:CCGGCAGAGGATATATCCCAGCAAACTCGAGTTTGCTGGGATATATCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-113s1c1
Sequence:CCGGGCGCCCTCTTACAGGACATTTCTCGAGAAATGTCCTGTAAGAGGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-601s1c1
Sequence:CCGGCCCGCCTACAACAGAGAGAAACTCGAGTTTCTCTCTGTTGTAGGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-828s1c1
Sequence:CCGGGCCACAGAGACACAATTCTTTCTCGAGAAAGAATTGTGTCTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_133264.2-1167s1c1
Sequence:CCGGCCGGTCTTTCTTGGATGATTTCTCGAGAAATCATCCAAGAAAGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-353s21c1
Sequence:CCGGGCGCCCTCTTACAGGACATTTCTCGAGAAATGTCCTGTAAGAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-1407s21c1
Sequence:CCGGCCGGTCTTTCTTGGATGATTTCTCGAGAAATCATCCAAGAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-1492s21c1
Sequence:CCGGCAGAGGATATATCCCAGCAAACTCGAGTTTGCTGGGATATATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-1068s21c1
Sequence:CCGGGCCACAGAGACACAATTCTTTCTCGAGAAAGAATTGTGTCTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133264
VALIDATED
WIPF2 MISSION shRNA shRNA Plasmid DNA
WAS/WASL interacting protein family, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-1252s1c1
Sequence:CCGGCAGAGGATATATCCCAGCAAACTCGAGTTTGCTGGGATATATCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-113s1c1
Sequence:CCGGGCGCCCTCTTACAGGACATTTCTCGAGAAATGTCCTGTAAGAGGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-601s1c1
Sequence:CCGGCCCGCCTACAACAGAGAGAAACTCGAGTTTCTCTCTGTTGTAGGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-828s1c1
Sequence:CCGGGCCACAGAGACACAATTCTTTCTCGAGAAAGAATTGTGTCTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_133264.2-1167s1c1
Sequence:CCGGCCGGTCTTTCTTGGATGATTTCTCGAGAAATCATCCAAGAAAGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-353s21c1
Sequence:CCGGGCGCCCTCTTACAGGACATTTCTCGAGAAATGTCCTGTAAGAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-1407s21c1
Sequence:CCGGCCGGTCTTTCTTGGATGATTTCTCGAGAAATCATCCAAGAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-1492s21c1
Sequence:CCGGCAGAGGATATATCCCAGCAAACTCGAGTTTGCTGGGATATATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-1068s21c1
Sequence:CCGGGCCACAGAGACACAATTCTTTCTCGAGAAAGAATTGTGTCTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133264
VALIDATED
WIPF2 MISSION shRNA Lentiviral Transduction Particles
WAS/WASL interacting protein family, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-1252s1c1
Sequence:CCGGCAGAGGATATATCCCAGCAAACTCGAGTTTGCTGGGATATATCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-113s1c1
Sequence:CCGGGCGCCCTCTTACAGGACATTTCTCGAGAAATGTCCTGTAAGAGGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-601s1c1
Sequence:CCGGCCCGCCTACAACAGAGAGAAACTCGAGTTTCTCTCTGTTGTAGGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133264.2-828s1c1
Sequence:CCGGGCCACAGAGACACAATTCTTTCTCGAGAAAGAATTGTGTCTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_133264.2-1167s1c1
Sequence:CCGGCCGGTCTTTCTTGGATGATTTCTCGAGAAATCATCCAAGAAAGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-353s21c1
Sequence:CCGGGCGCCCTCTTACAGGACATTTCTCGAGAAATGTCCTGTAAGAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-1407s21c1
Sequence:CCGGCCGGTCTTTCTTGGATGATTTCTCGAGAAATCATCCAAGAAAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-1492s21c1
Sequence:CCGGCAGAGGATATATCCCAGCAAACTCGAGTTTGCTGGGATATATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133264.4-1068s21c1
Sequence:CCGGGCCACAGAGACACAATTCTTTCTCGAGAAAGAATTGTGTCTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks