EMAIL THIS PAGE TO A FRIEND

WIPF3

WAS/WASL interacting protein family, member 3

Synonyms: CR16
UniProtKB ID: A6NGB9, B8ZZV2
Gene ID:
Mouse(330319) WAS/WASL interacting protein family, member 3
Rat(259242) WAS/WASL interacting protein family, member 3
chicken(420634) WAS/WASL interacting protein family, member 3
dog(100684384) WAS/WASL interacting protein family, member 3
domestic cat(101094008) WAS/WASL interacting protein family, member 3
cow(786606) WAS/WASL interacting protein family, member 3
sheep(101111451) WAS/WASL interacting protein family, member 3
domestic guinea pig(100721238) WAS/WASL interacting protein family, member 3
naked mole-rat(101725099) WAS/WASL interacting protein family, member 3
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080529 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080529 Rosetta Predictions human pricing
XM_929463 Rosetta Predictions human pricing
XM_933686 Rosetta Predictions human pricing
NM_147211 Rosetta Predictions rat pricing
XM_001481284 Rosetta Predictions mouse pricing
XM_620310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315727 predicted 1217
2 SASI_Hs02_00315728 predicted 1713
3 SASI_Hs02_00315729 predicted 1637
4 SASI_Hs02_00315730 predicted 1506
5 SASI_Hs02_00315731 predicted 1661
6 SASI_Hs02_00315732 predicted 1660
7 SASI_Hs02_00315733 predicted 1414
8 SASI_Hs02_00315734 predicted 1650
9 SASI_Hs02_00315735 predicted 1676
10 SASI_Hs02_00315736 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293535 predicted 1149
2 SASI_Hs01_00293536 predicted 1717
3 SASI_Hs01_00293537 predicted 1643
4 SASI_Hs01_00293538 predicted 1512
5 SASI_Hs01_00293539 predicted 1669
6 SASI_Hs01_00293540 predicted 941
7 SASI_Hs01_00293541 predicted 1673
8 SASI_Hs01_00293542 predicted 1417
9 SASI_Hs01_00293543 predicted 1661
10 SASI_Hs01_00293544 predicted 1681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292621 predicted 1390
2 SASI_Hs01_00292622 predicted 1398
3 SASI_Hs01_00292623 predicted 1255
4 SASI_Hs01_00292624 predicted 1213
5 SASI_Hs01_00292625 predicted 1243
6 SASI_Hs01_00292626 predicted 1273
7 SASI_Hs01_00292627 predicted 1149
8 SASI_Hs01_00292628 predicted 1222
9 SASI_Hs01_00292629 predicted 1406
10 SASI_Hs01_00292630 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085165 predicted 1929
2 SASI_Rn01_00085166 predicted 1502
3 SASI_Rn01_00085167 predicted 1954
4 SASI_Rn01_00085168 predicted 1752
5 SASI_Rn01_00085169 predicted 1694
6 SASI_Rn01_00085170 predicted 1811
7 SASI_Rn01_00085171 predicted 1542
8 SASI_Rn01_00085172 predicted 1703
9 SASI_Rn01_00085173 predicted 1596
10 SASI_Rn01_00085174 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423394 predicted 1625
2 SASI_Mm02_00423395 predicted 1780
3 SASI_Mm02_00423396 predicted 2072
4 SASI_Mm02_00423397 predicted 1633
5 SASI_Mm02_00423398 predicted 1728
6 SASI_Mm02_00423399 predicted 1774
7 SASI_Mm02_00423400 predicted 1496
8 SASI_Mm02_00423401 predicted 1298
9 SASI_Mm02_00423402 predicted 1258
10 SASI_Mm02_00423403 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427612 predicted 1729
2 SASI_Mm01_00271962 predicted 1571
3 SASI_Mm02_00427613 predicted 1879
4 SASI_Mm02_00427614 predicted 2176
5 SASI_Mm02_00427615 predicted 1737
6 SASI_Mm02_00427616 predicted 1833
7 SASI_Mm02_00427617 predicted 1870
8 SASI_Mm02_00427618 predicted 1499
9 SASI_Mm01_00271966 predicted 1563
10 SASI_Mm01_00271967 predicted 1298
11 SASI_Mm01_00271963 predicted 1288
12 SASI_Mm01_00271964 predicted 101
13 SASI_Mm01_00271965 predicted 135
14 SASI_Mm01_00271968 predicted 1327
15 SASI_Mm01_00271969 predicted 1250
16 SASI_Mm01_00271970 predicted 1305
17 SASI_Mm01_00271971 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080529
WIPF3 MISSION shRNA Bacterial Glycerol Stock
WAS/WASL interacting protein family, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-1210s21c1
Sequence:CCGGCCTGGAGGTCAACTGCGAAATCTCGAGATTTCGCAGTTGACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-138s21c1
Sequence:CCGGGAGTGCGCTGTTGGCTGATATCTCGAGATATCAGCCAACAGCGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-1246s21c1
Sequence:CCGGATTGATGACTTCGAGTCTAAACTCGAGTTTAGACTCGAAGTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080529.1-1978s21c1
Sequence:CCGGAGGGCATCTTGAACCGAATTACTCGAGTAATTCGGTTCAAGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-211s21c1
Sequence:CCGGCCGCAGATCGAGAGTTCTAAACTCGAGTTTAGAACTCTCGATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080529
WIPF3 MISSION shRNA shRNA Plasmid DNA
WAS/WASL interacting protein family, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-1210s21c1
Sequence:CCGGCCTGGAGGTCAACTGCGAAATCTCGAGATTTCGCAGTTGACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-138s21c1
Sequence:CCGGGAGTGCGCTGTTGGCTGATATCTCGAGATATCAGCCAACAGCGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-1246s21c1
Sequence:CCGGATTGATGACTTCGAGTCTAAACTCGAGTTTAGACTCGAAGTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080529.1-1978s21c1
Sequence:CCGGAGGGCATCTTGAACCGAATTACTCGAGTAATTCGGTTCAAGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-211s21c1
Sequence:CCGGCCGCAGATCGAGAGTTCTAAACTCGAGTTTAGAACTCTCGATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080529
WIPF3 MISSION shRNA Lentiviral Transduction Particles
WAS/WASL interacting protein family, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-1210s21c1
Sequence:CCGGCCTGGAGGTCAACTGCGAAATCTCGAGATTTCGCAGTTGACCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-138s21c1
Sequence:CCGGGAGTGCGCTGTTGGCTGATATCTCGAGATATCAGCCAACAGCGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-1246s21c1
Sequence:CCGGATTGATGACTTCGAGTCTAAACTCGAGTTTAGACTCGAAGTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080529.1-1978s21c1
Sequence:CCGGAGGGCATCTTGAACCGAATTACTCGAGTAATTCGGTTCAAGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080529.1-211s21c1
Sequence:CCGGCCGCAGATCGAGAGTTCTAAACTCGAGTTTAGAACTCTCGATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks