EMAIL THIS PAGE TO A FRIEND

WIPI1

WD repeat domain, phosphoinositide interacting 1

Synonyms: ATG18 ATG18A WIPI49
UniProtKB ID: Q5MNZ9, Q8IXM5, Q9NWF8
Gene ID:
Human(55062) Summary: WD40 repeat proteins are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins, such as WIPI1, have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids (Proikas-Cezanne et al., 2004 [PubMed 15602573]
Mouse(52639) WD repeat domain, phosphoinositide interacting 1
Rat(303630) WD repeat domain, phosphoinositide interacting 1
naked mole-rat(101722436) WD repeat domain, phosphoinositide interacting 1
domestic guinea pig(100730053) WD repeat domain, phosphoinositide interacting 1
cow(528410) WD repeat domain, phosphoinositide interacting 1
sheep(101109028) WD repeat domain, phosphoinositide interacting 1
Zebrafish(393362) WD repeat domain, phosphoinositide interacting 1
dog(490899) WD repeat domain, phosphoinositide interacting 1
domestic cat(101088378) WD repeat domain, phosphoinositide interacting 1
chicken(417437) WD repeat domain, phosphoinositide interacting 1
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017983 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145940 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145940 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145940 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017983 Rosetta Predictions human pricing
NM_001127297 Rosetta Predictions rat pricing
NM_145940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100301 predicted 519
2 SASI_Hs01_00100302 predicted 532
3 SASI_Hs01_00100303 predicted 437
4 SASI_Hs01_00100304 predicted 466
5 SASI_Hs01_00100306 predicted 1004
6 SASI_Hs02_00351022 predicted 548
7 SASI_Hs01_00100307 predicted 518
8 SASI_Hs01_00100308 predicted 1363
9 SASI_Hs01_00100309 predicted 1367
10 SASI_Hs02_00351023 predicted 583
11 SASI_Hs01_00100305 predicted 1066
12 SASI_Hs01_00100310 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253533 predicted 708
2 SASI_Rn02_00253534 predicted 334
3 SASI_Rn02_00253535 predicted 619
4 SASI_Rn02_00253536 predicted 302
5 SASI_Rn02_00253537 predicted 391
6 SASI_Rn02_00253538 predicted 401
7 SASI_Rn02_00253539 predicted 1350
8 SASI_Rn02_00253540 predicted 783
9 SASI_Rn02_00253541 predicted 1175
10 SASI_Rn02_00253542 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102054 predicted 450
2 SASI_Mm02_00341392 predicted 482
3 SASI_Mm02_00341393 predicted 1482
4 SASI_Mm01_00102056 predicted 1116
5 SASI_Mm01_00102057 predicted 735
6 SASI_Mm01_00102058 predicted 509
7 SASI_Mm01_00102059 predicted 431
8 SASI_Mm01_00102060 predicted 904
9 SASI_Mm01_00102061 predicted 1196
10 SASI_Mm01_00102063 predicted 230
11 SASI_Mm01_00102055 predicted 1338
12 SASI_Mm01_00102062 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017983
VALIDATED
WIPI1 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain, phosphoinositide interacting 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017983.5-1625s21c1
Sequence:CCGGCGGGAGACATTGTATACACATCTCGAGATGTGTATACAATGTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017983.5-533s21c1
Sequence:CCGGCTCTCTATCAACCATTCCAATCTCGAGATTGGAATGGTTGATAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017983.5-1498s21c1
Sequence:CCGGGCGGAAGAATGGAGTGCAATTCTCGAGAATTGCACTCCATTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017983.5-334s21c1
Sequence:CCGGGCAGATGAACGTGTATCACTTCTCGAGAAGTGATACACGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017983.3-806s1c1
Sequence:CCGGCGAGACGGTACACATCTTCAACTCGAGTTGAAGATGTGTACCGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017983.3-1323s1c1
Sequence:CCGGGAGAATGAGTTTCCTCCTATACTCGAGTATAGGAGGAAACTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017983.3-489s1c1
Sequence:CCGGCTCTCTATCAACCATTCCAATCTCGAGATTGGAATGGTTGATAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017983.3-1581s1c1
Sequence:CCGGCGGGAGACATTGTATACACATCTCGAGATGTGTATACAATGTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017983.3-290s1c1
Sequence:CCGGGCAGATGAACGTGTATCACTTCTCGAGAAGTGATACACGTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017983.3-1353s1c1
Sequence:CCGGCGTGGAAATCAGAAGGGCAAACTCGAGTTTGCCCTTCTGATTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017983.3-1454s1c1
Sequence:CCGGGCGGAAGAATGGAGTGCAATTCTCGAGAATTGCACTCCATTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017983
VALIDATED
WIPI1 MISSION shRNA shRNA Plasmid DNA
WD repeat domain, phosphoinositide interacting 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017983.5-1625s21c1
Sequence:CCGGCGGGAGACATTGTATACACATCTCGAGATGTGTATACAATGTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017983.5-533s21c1
Sequence:CCGGCTCTCTATCAACCATTCCAATCTCGAGATTGGAATGGTTGATAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017983.5-1498s21c1
Sequence:CCGGGCGGAAGAATGGAGTGCAATTCTCGAGAATTGCACTCCATTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017983.5-334s21c1
Sequence:CCGGGCAGATGAACGTGTATCACTTCTCGAGAAGTGATACACGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017983.3-806s1c1
Sequence:CCGGCGAGACGGTACACATCTTCAACTCGAGTTGAAGATGTGTACCGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017983.3-1323s1c1
Sequence:CCGGGAGAATGAGTTTCCTCCTATACTCGAGTATAGGAGGAAACTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017983.3-489s1c1
Sequence:CCGGCTCTCTATCAACCATTCCAATCTCGAGATTGGAATGGTTGATAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017983.3-1581s1c1
Sequence:CCGGCGGGAGACATTGTATACACATCTCGAGATGTGTATACAATGTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017983.3-290s1c1
Sequence:CCGGGCAGATGAACGTGTATCACTTCTCGAGAAGTGATACACGTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017983.3-1353s1c1
Sequence:CCGGCGTGGAAATCAGAAGGGCAAACTCGAGTTTGCCCTTCTGATTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017983.3-1454s1c1
Sequence:CCGGGCGGAAGAATGGAGTGCAATTCTCGAGAATTGCACTCCATTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017983
VALIDATED
WIPI1 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain, phosphoinositide interacting 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_017983.5-1625s21c1
Sequence:CCGGCGGGAGACATTGTATACACATCTCGAGATGTGTATACAATGTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017983.5-533s21c1
Sequence:CCGGCTCTCTATCAACCATTCCAATCTCGAGATTGGAATGGTTGATAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017983.5-1498s21c1
Sequence:CCGGGCGGAAGAATGGAGTGCAATTCTCGAGAATTGCACTCCATTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017983.5-334s21c1
Sequence:CCGGGCAGATGAACGTGTATCACTTCTCGAGAAGTGATACACGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017983.3-806s1c1
Sequence:CCGGCGAGACGGTACACATCTTCAACTCGAGTTGAAGATGTGTACCGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017983.3-1323s1c1
Sequence:CCGGGAGAATGAGTTTCCTCCTATACTCGAGTATAGGAGGAAACTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017983.3-489s1c1
Sequence:CCGGCTCTCTATCAACCATTCCAATCTCGAGATTGGAATGGTTGATAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152429    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017983.3-1581s1c1
Sequence:CCGGCGGGAGACATTGTATACACATCTCGAGATGTGTATACAATGTCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017983.3-290s1c1
Sequence:CCGGGCAGATGAACGTGTATCACTTCTCGAGAAGTGATACACGTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017983.3-1353s1c1
Sequence:CCGGCGTGGAAATCAGAAGGGCAAACTCGAGTTTGCCCTTCTGATTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017983.3-1454s1c1
Sequence:CCGGGCGGAAGAATGGAGTGCAATTCTCGAGAATTGCACTCCATTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145940
VALIDATED
WIPI1 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain, phosphoinositide interacting 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-242s21c1
Sequence:CCGGTGAAATCCCTGACGTGTATATCTCGAGATATACACGTCAGGGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145940.2-321s1c1
Sequence:CCGGCAGATGAACGTCTACCATTTCCTCGAGGAAATGGTAGACGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-1479s21c1
Sequence:CCGGGAAAGTGGAAGAAACGGAATACTCGAGTATTCCGTTTCTTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-1306s21c1
Sequence:CCGGTTATTCCGGAACACGAGTTTGCTCGAGCAAACTCGTGTTCCGGAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-321s21c1
Sequence:CCGGCAGATGAACGTCTACCATTTCCTCGAGGAAATGGTAGACGTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-436s21c1
Sequence:CCGGCCATCTATATCCACAACATTACTCGAGTAATGTTGTGGATATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145940.1-1212s1c1
Sequence:CCGGCCATCTTATGCTGCAACTGTACTCGAGTACAGTTGCAGCATAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145940.1-743s1c1
Sequence:CCGGCTATGAGTTTCGTCGAGGAATCTCGAGATTCCTCGACGAAACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145940
VALIDATED
WIPI1 MISSION shRNA shRNA Plasmid DNA
WD repeat domain, phosphoinositide interacting 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-242s21c1
Sequence:CCGGTGAAATCCCTGACGTGTATATCTCGAGATATACACGTCAGGGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145940.2-321s1c1
Sequence:CCGGCAGATGAACGTCTACCATTTCCTCGAGGAAATGGTAGACGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-1479s21c1
Sequence:CCGGGAAAGTGGAAGAAACGGAATACTCGAGTATTCCGTTTCTTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-1306s21c1
Sequence:CCGGTTATTCCGGAACACGAGTTTGCTCGAGCAAACTCGTGTTCCGGAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-321s21c1
Sequence:CCGGCAGATGAACGTCTACCATTTCCTCGAGGAAATGGTAGACGTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-436s21c1
Sequence:CCGGCCATCTATATCCACAACATTACTCGAGTAATGTTGTGGATATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145940.1-1212s1c1
Sequence:CCGGCCATCTTATGCTGCAACTGTACTCGAGTACAGTTGCAGCATAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145940.1-743s1c1
Sequence:CCGGCTATGAGTTTCGTCGAGGAATCTCGAGATTCCTCGACGAAACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145940
VALIDATED
WIPI1 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain, phosphoinositide interacting 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-242s21c1
Sequence:CCGGTGAAATCCCTGACGTGTATATCTCGAGATATACACGTCAGGGATTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145940.2-321s1c1
Sequence:CCGGCAGATGAACGTCTACCATTTCCTCGAGGAAATGGTAGACGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-1479s21c1
Sequence:CCGGGAAAGTGGAAGAAACGGAATACTCGAGTATTCCGTTTCTTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-1306s21c1
Sequence:CCGGTTATTCCGGAACACGAGTTTGCTCGAGCAAACTCGTGTTCCGGAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-321s21c1
Sequence:CCGGCAGATGAACGTCTACCATTTCCTCGAGGAAATGGTAGACGTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145940.2-436s21c1
Sequence:CCGGCCATCTATATCCACAACATTACTCGAGTAATGTTGTGGATATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145940.1-1212s1c1
Sequence:CCGGCCATCTTATGCTGCAACTGTACTCGAGTACAGTTGCAGCATAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145940.1-743s1c1
Sequence:CCGGCTATGAGTTTCGTCGAGGAATCTCGAGATTCCTCGACGAAACTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks