EMAIL THIS PAGE TO A FRIEND

WIPI2

WD repeat domain, phosphoinositide interacting 2

Synonyms: ATG18B Atg21 WIPI-2
Gene ID:
Human(26100) Summary: WD40 repeat proteins are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins, such as WIPI2, have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids (Proikas-Cezanne et al., 2004 [PubMed 15602573]
Mouse(74781) WD repeat domain, phosphoinositide interacting 2
Rat(288498) WD repeat domain, phosphoinositide interacting 2
Zebrafish(437002) WD repeat domain, phosphoinositide interacting 2
domestic cat(101095300) WD repeat domain, phosphoinositide interacting 2
Horse(100060823) WD repeat domain, phosphoinositide interacting 2
dog(608721) WD repeat domain, phosphoinositide interacting 2
chicken(416481) WD repeat domain, phosphoinositide interacting 2
cow(512685) WD repeat domain, phosphoinositide interacting 2
sheep(101109238) WD repeat domain, phosphoinositide interacting 2
domestic guinea pig(100732480) WD repeat domain, phosphoinositide interacting 2
naked mole-rat(101722837) WD repeat domain, phosphoinositide interacting 2
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015610 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033518 Rosetta Predictions human pricing
NM_001033519 Rosetta Predictions human pricing
NM_001033520 Rosetta Predictions human pricing
NM_015610 Rosetta Predictions human pricing
NM_016003 Rosetta Predictions human pricing
NM_001007615 Rosetta Predictions rat pricing
NM_178398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035706 predicted 644
2 SASI_Hs01_00035707 predicted 924
3 SASI_Hs01_00035708 predicted 1019
4 SASI_Hs01_00035709 predicted 702
5 SASI_Hs01_00035710 predicted 857
6 SASI_Hs01_00035711 predicted 824
7 SASI_Hs01_00035712 predicted 2014
8 SASI_Hs01_00035713 predicted 985
9 SASI_Hs01_00035714 predicted 693
10 SASI_Hs01_00035715 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101455 predicted 587
2 SASI_Hs01_00101456 predicted 875
3 SASI_Hs01_00101457 predicted 965
4 SASI_Hs01_00101458 predicted 642
5 SASI_Hs01_00101459 predicted 807
6 SASI_Hs01_00101460 predicted 764
7 SASI_Hs01_00101461 predicted 1961
8 SASI_Hs01_00101462 predicted 929
9 SASI_Hs01_00101463 predicted 635
10 SASI_Hs01_00101464 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195433 predicted 479
2 SASI_Hs01_00195434 predicted 764
3 SASI_Hs01_00195435 predicted 854
4 SASI_Hs01_00195436 predicted 542
5 SASI_Hs01_00195437 predicted 699
6 SASI_Hs01_00195438 predicted 663
7 SASI_Hs01_00195439 predicted 1850
8 SASI_Hs01_00195440 predicted 818
9 SASI_Hs01_00195441 predicted 529
10 SASI_Hs01_00195442 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015099 predicted 641
2 SASI_Hs01_00015100 predicted 932
3 SASI_Hs01_00015101 predicted 1013
4 SASI_Hs01_00015102 predicted 704
5 SASI_Hs01_00015103 predicted 860
6 SASI_Hs01_00015104 predicted 818
7 SASI_Hs01_00015105 predicted 2047
8 SASI_Hs01_00015106 predicted 984
9 SASI_Hs01_00015107 predicted 688
10 SASI_Hs01_00015108 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222841 predicted 590
2 SASI_Hs01_00222842 predicted 872
3 SASI_Hs01_00222843 predicted 958
4 SASI_Hs01_00222844 predicted 643
5 SASI_Hs01_00222845 predicted 806
6 SASI_Hs01_00222846 predicted 771
7 SASI_Hs01_00222847 predicted 1995
8 SASI_Hs01_00222848 predicted 922
9 SASI_Hs01_00222849 predicted 634
10 SASI_Hs01_00222850 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098188 predicted 276
2 SASI_Rn02_00198704 predicted 562
3 SASI_Rn01_00098190 predicted 945
4 SASI_Rn01_00098191 predicted 847
5 SASI_Rn02_00198705 predicted 806
6 SASI_Rn01_00098192 predicted 369
7 SASI_Rn01_00098193 predicted 1275
8 SASI_Rn01_00098194 predicted 526
9 SASI_Rn01_00098195 predicted 1013
10 SASI_Rn01_00098196 predicted 615
11 SASI_Rn01_00098189 predicted 497
12 SASI_Rn01_00098197 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201527 predicted 260
2 SASI_Mm01_00201528 predicted 256
3 SASI_Mm01_00201530 predicted 1167
4 SASI_Mm01_00201531 predicted 1245
5 SASI_Mm01_00201533 predicted 1403
6 SASI_Mm01_00201534 predicted 261
7 SASI_Mm01_00201535 predicted 996
8 SASI_Mm01_00201536 predicted 595
9 SASI_Mm02_00348818 predicted 1170
10 SASI_Mm02_00348819 predicted 1120
11 SASI_Mm01_00201529 predicted 1187
12 SASI_Mm01_00201532 predicted 635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178398
VALIDATED
WIPI2 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain, phosphoinositide interacting 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178398.2-551s1c1
Sequence:CCGGGTCGCTCTACATACACAACATCTCGAGATGTTGTGTATGTAGAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178398.2-461s1c1
Sequence:CCGGGAAGGGAACTGAGATATGCAACTCGAGTTGCATATCTCAGTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178398.2-386s1c1
Sequence:CCGGGAGATTGTTCTCAAGCAGCTTCTCGAGAAGCTGCTTGAGAACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178398.2-1720s1c1
Sequence:CCGGCCTGCTTATGAATTTAGCTTTCTCGAGAAAGCTAAATTCATAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178398.2-698s1c1
Sequence:CCGGGCAGGTCTTCGACACCATTAACTCGAGTTAATGGTGTCGAAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178398.2-3472s1c1
Sequence:CCGGCCTCACTTGGAAACTTGGTTACTCGAGTAACCAAGTTTCCAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178398.4-436s21c1
Sequence:CCGGGAAGGGAACTGAGATATGCAACTCGAGTTGCATATCTCAGTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178398.4-601s1c1
Sequence:CCGGCTTGTGTGCACTGTCAATAAACTCGAGTTTATTGACAGTGCACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178398.4-361s21c1
Sequence:CCGGGAGATTGTTCTCAAGCAGCTTCTCGAGAAGCTGCTTGAGAACAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178398.4-526s21c1
Sequence:CCGGGTCGCTCTACATACACAACATCTCGAGATGTTGTGTATGTAGAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178398.4-1695s21c1
Sequence:CCGGCCTGCTTATGAATTTAGCTTTCTCGAGAAAGCTAAATTCATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178398
VALIDATED
WIPI2 MISSION shRNA shRNA Plasmid DNA
WD repeat domain, phosphoinositide interacting 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178398.2-551s1c1
Sequence:CCGGGTCGCTCTACATACACAACATCTCGAGATGTTGTGTATGTAGAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178398.2-461s1c1
Sequence:CCGGGAAGGGAACTGAGATATGCAACTCGAGTTGCATATCTCAGTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178398.2-386s1c1
Sequence:CCGGGAGATTGTTCTCAAGCAGCTTCTCGAGAAGCTGCTTGAGAACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178398.2-1720s1c1
Sequence:CCGGCCTGCTTATGAATTTAGCTTTCTCGAGAAAGCTAAATTCATAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178398.2-698s1c1
Sequence:CCGGGCAGGTCTTCGACACCATTAACTCGAGTTAATGGTGTCGAAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178398.2-3472s1c1
Sequence:CCGGCCTCACTTGGAAACTTGGTTACTCGAGTAACCAAGTTTCCAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178398.4-436s21c1
Sequence:CCGGGAAGGGAACTGAGATATGCAACTCGAGTTGCATATCTCAGTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178398.4-601s1c1
Sequence:CCGGCTTGTGTGCACTGTCAATAAACTCGAGTTTATTGACAGTGCACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178398.4-361s21c1
Sequence:CCGGGAGATTGTTCTCAAGCAGCTTCTCGAGAAGCTGCTTGAGAACAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178398.4-526s21c1
Sequence:CCGGGTCGCTCTACATACACAACATCTCGAGATGTTGTGTATGTAGAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178398.4-1695s21c1
Sequence:CCGGCCTGCTTATGAATTTAGCTTTCTCGAGAAAGCTAAATTCATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178398
VALIDATED
WIPI2 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain, phosphoinositide interacting 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178398.2-551s1c1
Sequence:CCGGGTCGCTCTACATACACAACATCTCGAGATGTTGTGTATGTAGAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178398.2-461s1c1
Sequence:CCGGGAAGGGAACTGAGATATGCAACTCGAGTTGCATATCTCAGTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178398.2-386s1c1
Sequence:CCGGGAGATTGTTCTCAAGCAGCTTCTCGAGAAGCTGCTTGAGAACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178398.2-1720s1c1
Sequence:CCGGCCTGCTTATGAATTTAGCTTTCTCGAGAAAGCTAAATTCATAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178398.2-698s1c1
Sequence:CCGGGCAGGTCTTCGACACCATTAACTCGAGTTAATGGTGTCGAAGACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197981    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178398.2-3472s1c1
Sequence:CCGGCCTCACTTGGAAACTTGGTTACTCGAGTAACCAAGTTTCCAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178398.4-436s21c1
Sequence:CCGGGAAGGGAACTGAGATATGCAACTCGAGTTGCATATCTCAGTTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178398.4-601s1c1
Sequence:CCGGCTTGTGTGCACTGTCAATAAACTCGAGTTTATTGACAGTGCACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178398.4-361s21c1
Sequence:CCGGGAGATTGTTCTCAAGCAGCTTCTCGAGAAGCTGCTTGAGAACAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178398.4-526s21c1
Sequence:CCGGGTCGCTCTACATACACAACATCTCGAGATGTTGTGTATGTAGAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178398.4-1695s21c1
Sequence:CCGGCCTGCTTATGAATTTAGCTTTCTCGAGAAAGCTAAATTCATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015610
VALIDATED
WIPI2 MISSION shRNA Bacterial Glycerol Stock
WD repeat domain, phosphoinositide interacting 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-348s1c1
Sequence:CCGGCCCTAGCTGTTGGTAGTAAGTCTCGAGACTTACTACCAACAGCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015610.1-490s1c1
Sequence:CCGGGAGCCTTAAAGCACCAAGGAACTCGAGTTCCTTGGTGCTTTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-1135s1c1
Sequence:CCGGGCCTTCCCAAGTGACAGAAATCTCGAGATTTCTGTCACTTGGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015610.1-783s1c1
Sequence:CCGGCCATTAATTTGAGAGCTGCAACTCGAGTTGCAGCTCTCAAATTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-511s1c1
Sequence:CCGGGCTAAAGGTTTGCCACTTTAACTCGAGTTAAAGTGGCAAACCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015610.1-706s1c1
Sequence:CCGGGCTGTCAATCAACAACGACAACTCGAGTTGTCGTTGTTGATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015610.1-431s1c1
Sequence:CCGGGATACGGAAGATGTGTGCATTCTCGAGAATGCACACATCTTCCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015610.1-858s1c1
Sequence:CCGGGAACTAAACTTGCCACGGCTTCTCGAGAAGCCGTGGCAAGTTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-1025s1c1
Sequence:CCGGGAGACCGTGCACATCTTCAAACTCGAGTTTGAAGATGTGCACGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-1270s1c1
Sequence:CCGGCGGGTACCTGTACATGTACAACTCGAGTTGTACATGTACAGGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015610
VALIDATED
WIPI2 MISSION shRNA shRNA Plasmid DNA
WD repeat domain, phosphoinositide interacting 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-348s1c1
Sequence:CCGGCCCTAGCTGTTGGTAGTAAGTCTCGAGACTTACTACCAACAGCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015610.1-490s1c1
Sequence:CCGGGAGCCTTAAAGCACCAAGGAACTCGAGTTCCTTGGTGCTTTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-1135s1c1
Sequence:CCGGGCCTTCCCAAGTGACAGAAATCTCGAGATTTCTGTCACTTGGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015610.1-783s1c1
Sequence:CCGGCCATTAATTTGAGAGCTGCAACTCGAGTTGCAGCTCTCAAATTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-511s1c1
Sequence:CCGGGCTAAAGGTTTGCCACTTTAACTCGAGTTAAAGTGGCAAACCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015610.1-706s1c1
Sequence:CCGGGCTGTCAATCAACAACGACAACTCGAGTTGTCGTTGTTGATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015610.1-431s1c1
Sequence:CCGGGATACGGAAGATGTGTGCATTCTCGAGAATGCACACATCTTCCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015610.1-858s1c1
Sequence:CCGGGAACTAAACTTGCCACGGCTTCTCGAGAAGCCGTGGCAAGTTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-1025s1c1
Sequence:CCGGGAGACCGTGCACATCTTCAAACTCGAGTTTGAAGATGTGCACGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-1270s1c1
Sequence:CCGGCGGGTACCTGTACATGTACAACTCGAGTTGTACATGTACAGGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015610
VALIDATED
WIPI2 MISSION shRNA Lentiviral Transduction Particles
WD repeat domain, phosphoinositide interacting 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-348s1c1
Sequence:CCGGCCCTAGCTGTTGGTAGTAAGTCTCGAGACTTACTACCAACAGCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015610.1-490s1c1
Sequence:CCGGGAGCCTTAAAGCACCAAGGAACTCGAGTTCCTTGGTGCTTTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-1135s1c1
Sequence:CCGGGCCTTCCCAAGTGACAGAAATCTCGAGATTTCTGTCACTTGGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015610.1-783s1c1
Sequence:CCGGCCATTAATTTGAGAGCTGCAACTCGAGTTGCAGCTCTCAAATTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-511s1c1
Sequence:CCGGGCTAAAGGTTTGCCACTTTAACTCGAGTTAAAGTGGCAAACCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015610.1-706s1c1
Sequence:CCGGGCTGTCAATCAACAACGACAACTCGAGTTGTCGTTGTTGATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015610.1-431s1c1
Sequence:CCGGGATACGGAAGATGTGTGCATTCTCGAGAATGCACACATCTTCCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015610.1-858s1c1
Sequence:CCGGGAACTAAACTTGCCACGGCTTCTCGAGAAGCCGTGGCAAGTTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-1025s1c1
Sequence:CCGGGAGACCGTGCACATCTTCAAACTCGAGTTTGAAGATGTGCACGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015610.1-1270s1c1
Sequence:CCGGCGGGTACCTGTACATGTACAACTCGAGTTGTACATGTACAGGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks