EMAIL THIS PAGE TO A FRIEND

WISP1

WNT1 inducible signaling pathway protein 1

Synonyms: CCN4 WISP1c WISP1i WISP1tc
UniProtKB ID: O95388, A8KAG6, E7EMM5, Q5JBS6, Q5JBS8, Q9HCS3
Gene ID:
Human(8840) Summary: This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011]
Mouse(22402) WNT1 inducible signaling pathway protein 1
Rat(65154) WNT1 inducible signaling pathway protein 1
chicken(420322) WNT1 inducible signaling pathway protein 1
dog(482048) WNT1 inducible signaling pathway protein 1
domestic cat(101093993) WNT1 inducible signaling pathway protein 1
domestic guinea pig(100729064) WNT1 inducible signaling pathway protein 1
naked mole-rat(101722605) WNT1 inducible signaling pathway protein 1
cow(539163) WNT1 inducible signaling pathway protein 1
sheep(101120418) WNT1 inducible signaling pathway protein 1
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003882 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081951 MISSION® esiRNA esiRNA human WISP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003882 Rosetta Predictions human pricing
NM_080838 Rosetta Predictions human pricing
NM_031716 Rosetta Predictions rat pricing
NM_018865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162796 predicted 1041
2 SASI_Hs01_00162797 predicted 1023
3 SASI_Hs01_00162798 predicted 933
4 SASI_Hs01_00162799 predicted 947
5 SASI_Hs01_00162801 predicted 938
6 SASI_Hs01_00162802 predicted 1011
7 SASI_Hs01_00162803 predicted 963
8 SASI_Hs01_00162805 predicted 1025
9 SASI_Hs02_00336490 predicted 946
10 SASI_Hs02_00336491 predicted 1010
11 SASI_Hs01_00162800 predicted 978
12 SASI_Hs01_00162804 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127678 predicted 784
2 SASI_Hs01_00127679 predicted 763
3 SASI_Hs01_00127680 predicted 678
4 SASI_Hs01_00127681 predicted 688
5 SASI_Hs01_00127683 predicted 676
6 SASI_Hs01_00127684 predicted 742
7 SASI_Hs01_00127685 predicted 702
8 SASI_Hs01_00127687 predicted 764
9 SASI_Hs02_00362629 predicted 683
10 SASI_Hs02_00362630 predicted 758
11 SASI_Hs01_00127682 predicted 719
12 SASI_Hs01_00127686 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118717 predicted 856
2 SASI_Rn01_00118718 predicted 286
3 SASI_Rn01_00118719 predicted 1199
4 SASI_Rn01_00118720 predicted 581
5 SASI_Rn01_00118721 predicted 1100
6 SASI_Rn01_00118722 predicted 1060
7 SASI_Rn01_00118723 predicted 1331
8 SASI_Rn01_00118724 predicted 1053
9 SASI_Rn01_00118725 predicted 1071
10 SASI_Rn02_00265085 predicted 1116
11 SASI_Rn01_00118716 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061775 predicted 586
2 SASI_Mm01_00061776 predicted 863
3 SASI_Mm01_00061778 predicted 1316
4 SASI_Mm02_00324240 predicted 1212
5 SASI_Mm02_00324241 predicted 943
6 SASI_Mm01_00061781 predicted 301
7 SASI_Mm01_00061782 predicted 1072
8 SASI_Mm02_00324242 predicted 1151
9 SASI_Mm01_00061783 predicted 1086
10 SASI_Mm01_00061784 predicted 1369
11 SASI_Mm01_00061777 predicted 1211
12 SASI_Mm01_00061779 predicted 967
13 SASI_Mm01_00061780 predicted 1298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003882
WISP1 MISSION shRNA Bacterial Glycerol Stock
WNT1 inducible signaling pathway protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003882.2-1070s21c1
Sequence:CCGGCGCCAGGTCCTATGGATTAATCTCGAGATTAATCCATAGGACCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003882.2-1625s21c1
Sequence:CCGGGAGGTACTGTAATGGGTAATTCTCGAGAATTACCCATTACAGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003882.2-1373s21c1
Sequence:CCGGTCATTCAGCATCTACTCTAAACTCGAGTTTAGAGTAGATGCTGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-917s1c1
Sequence:CCGGGCATCCATGAACTTCACACTTCTCGAGAAGTGTGAAGTTCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-289s1c1
Sequence:CCGGTGGCTGTGAGTGCTGTAAGATCTCGAGATCTTACAGCACTCACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-1095s1c1
Sequence:CCGGGCTTCTGTAACCTGAGCTGTACTCGAGTACAGCTCAGGTTACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-976s1c1
Sequence:CCGGCTGTGGAGTTTGCATGGACAACTCGAGTTGTCCATGCAAACTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-780s1c1
Sequence:CCGGCCACTCGGATCTCCAATGTTACTCGAGTAACATTGGAGATCCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003882
WISP1 MISSION shRNA shRNA Plasmid DNA
WNT1 inducible signaling pathway protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003882.2-1070s21c1
Sequence:CCGGCGCCAGGTCCTATGGATTAATCTCGAGATTAATCCATAGGACCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003882.2-1625s21c1
Sequence:CCGGGAGGTACTGTAATGGGTAATTCTCGAGAATTACCCATTACAGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003882.2-1373s21c1
Sequence:CCGGTCATTCAGCATCTACTCTAAACTCGAGTTTAGAGTAGATGCTGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-917s1c1
Sequence:CCGGGCATCCATGAACTTCACACTTCTCGAGAAGTGTGAAGTTCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-289s1c1
Sequence:CCGGTGGCTGTGAGTGCTGTAAGATCTCGAGATCTTACAGCACTCACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-1095s1c1
Sequence:CCGGGCTTCTGTAACCTGAGCTGTACTCGAGTACAGCTCAGGTTACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-976s1c1
Sequence:CCGGCTGTGGAGTTTGCATGGACAACTCGAGTTGTCCATGCAAACTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-780s1c1
Sequence:CCGGCCACTCGGATCTCCAATGTTACTCGAGTAACATTGGAGATCCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003882
WISP1 MISSION shRNA Lentiviral Transduction Particles
WNT1 inducible signaling pathway protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003882.2-1070s21c1
Sequence:CCGGCGCCAGGTCCTATGGATTAATCTCGAGATTAATCCATAGGACCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003882.2-1625s21c1
Sequence:CCGGGAGGTACTGTAATGGGTAATTCTCGAGAATTACCCATTACAGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003882.2-1373s21c1
Sequence:CCGGTCATTCAGCATCTACTCTAAACTCGAGTTTAGAGTAGATGCTGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-917s1c1
Sequence:CCGGGCATCCATGAACTTCACACTTCTCGAGAAGTGTGAAGTTCATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-289s1c1
Sequence:CCGGTGGCTGTGAGTGCTGTAAGATCTCGAGATCTTACAGCACTCACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-1095s1c1
Sequence:CCGGGCTTCTGTAACCTGAGCTGTACTCGAGTACAGCTCAGGTTACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-976s1c1
Sequence:CCGGCTGTGGAGTTTGCATGGACAACTCGAGTTGTCCATGCAAACTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003882.2-780s1c1
Sequence:CCGGCCACTCGGATCTCCAATGTTACTCGAGTAACATTGGAGATCCGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018865
VALIDATED
WISP1 MISSION shRNA Bacterial Glycerol Stock
WNT1 inducible signaling pathway protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-388s21c1
Sequence:CCGGGCTGTGAATGCTGTAAGATATCTCGAGATATCTTACAGCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-1726s21c1
Sequence:CCGGTGATACTATCCTGGGTATTTCCTCGAGGAAATACCCAGGATAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-880s21c1
Sequence:CCGGCTCGGATCTCTAACGTCAATGCTCGAGCATTGACGTTAGAGATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018865.2-1167s21c1
Sequence:CCGGCGGCAGGTCCTATGGATTAATCTCGAGATTAATCCATAGGACCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-804s21c1
Sequence:CCGGCAACGGTATGAGAACTGCATACTCGAGTATGCAGTTCTCATACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018865.1-388s1c1
Sequence:CCGGGCTGTGAATGCTGTAAGATATCTCGAGATATCTTACAGCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018865.1-1117s1c1
Sequence:CCGGCCAAGACCATCAGTGTGGATTCTCGAGAATCCACACTGATGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018865.1-804s1c1
Sequence:CCGGCAACGGTATGAGAACTGCATACTCGAGTATGCAGTTCTCATACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018865.1-1207s1c1
Sequence:CCGGGCTGCAGGAATCCTAACGATACTCGAGTATCGTTAGGATTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018865.1-945s1c1
Sequence:CCGGCCATGTGATGTGGACATCCAACTCGAGTTGGATGTCCACATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018865
VALIDATED
WISP1 MISSION shRNA shRNA Plasmid DNA
WNT1 inducible signaling pathway protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-388s21c1
Sequence:CCGGGCTGTGAATGCTGTAAGATATCTCGAGATATCTTACAGCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-1726s21c1
Sequence:CCGGTGATACTATCCTGGGTATTTCCTCGAGGAAATACCCAGGATAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-880s21c1
Sequence:CCGGCTCGGATCTCTAACGTCAATGCTCGAGCATTGACGTTAGAGATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018865.2-1167s21c1
Sequence:CCGGCGGCAGGTCCTATGGATTAATCTCGAGATTAATCCATAGGACCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-804s21c1
Sequence:CCGGCAACGGTATGAGAACTGCATACTCGAGTATGCAGTTCTCATACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018865.1-388s1c1
Sequence:CCGGGCTGTGAATGCTGTAAGATATCTCGAGATATCTTACAGCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018865.1-1117s1c1
Sequence:CCGGCCAAGACCATCAGTGTGGATTCTCGAGAATCCACACTGATGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018865.1-804s1c1
Sequence:CCGGCAACGGTATGAGAACTGCATACTCGAGTATGCAGTTCTCATACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018865.1-1207s1c1
Sequence:CCGGGCTGCAGGAATCCTAACGATACTCGAGTATCGTTAGGATTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018865.1-945s1c1
Sequence:CCGGCCATGTGATGTGGACATCCAACTCGAGTTGGATGTCCACATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018865
VALIDATED
WISP1 MISSION shRNA Lentiviral Transduction Particles
WNT1 inducible signaling pathway protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-388s21c1
Sequence:CCGGGCTGTGAATGCTGTAAGATATCTCGAGATATCTTACAGCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-1726s21c1
Sequence:CCGGTGATACTATCCTGGGTATTTCCTCGAGGAAATACCCAGGATAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-880s21c1
Sequence:CCGGCTCGGATCTCTAACGTCAATGCTCGAGCATTGACGTTAGAGATCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018865.2-1167s21c1
Sequence:CCGGCGGCAGGTCCTATGGATTAATCTCGAGATTAATCCATAGGACCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018865.2-804s21c1
Sequence:CCGGCAACGGTATGAGAACTGCATACTCGAGTATGCAGTTCTCATACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018865.1-388s1c1
Sequence:CCGGGCTGTGAATGCTGTAAGATATCTCGAGATATCTTACAGCATTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018865.1-1117s1c1
Sequence:CCGGCCAAGACCATCAGTGTGGATTCTCGAGAATCCACACTGATGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018865.1-804s1c1
Sequence:CCGGCAACGGTATGAGAACTGCATACTCGAGTATGCAGTTCTCATACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018865.1-1207s1c1
Sequence:CCGGGCTGCAGGAATCCTAACGATACTCGAGTATCGTTAGGATTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018865.1-945s1c1
Sequence:CCGGCCATGTGATGTGGACATCCAACTCGAGTTGGATGTCCACATCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks