EMAIL THIS PAGE TO A FRIEND

WISP2

WNT1 inducible signaling pathway protein 2

Synonyms: CCN5 CT58 CTGF-L
UniProtKB ID: O76076, B2R9N4, E1P612
Gene ID:
Human(8839) Summary: This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. [provided by RefSeq, Jul 2008]
Mouse(22403) WNT1 inducible signaling pathway protein 2
Rat(29576) WNT1 inducible signaling pathway protein 2
Zebrafish(100007759) WNT1 inducible signaling pathway protein 2
chicken(419192) WNT1 inducible signaling pathway protein 2
dog(610928) WNT1 inducible signaling pathway protein 2
domestic cat(101091930) WNT1 inducible signaling pathway protein 2
cow(534658) WNT1 inducible signaling pathway protein 2
sheep(101106613) WNT1 inducible signaling pathway protein 2
naked mole-rat(101706687) WNT1 inducible signaling pathway protein 2
domestic guinea pig(100721143) WNT1 inducible signaling pathway protein 2
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003881 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003881 Rosetta Predictions human pricing
NM_031590 Rosetta Predictions rat pricing
NM_016873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031678 predicted 801
2 SASI_Hs01_00031679 predicted 1060
3 SASI_Hs01_00031680 predicted 1023
4 SASI_Hs01_00031681 predicted 445
5 SASI_Hs01_00031682 predicted 1005
6 SASI_Hs01_00031683 predicted 992
7 SASI_Hs01_00031684 predicted 1024
8 SASI_Hs01_00031685 predicted 1164
9 SASI_Hs01_00031686 predicted 1078
10 SASI_Hs01_00031687 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106010 predicted 1279
2 SASI_Rn01_00106012 predicted 702
3 SASI_Rn01_00106013 predicted 1396
4 SASI_Rn02_00264861 predicted 1281
5 SASI_Rn01_00106014 predicted 1411
6 SASI_Rn01_00106015 predicted 1413
7 SASI_Rn02_00264862 predicted 1377
8 SASI_Rn01_00106016 predicted 1132
9 SASI_Rn01_00106018 predicted 1112
10 SASI_Rn02_00264863 predicted 789
11 SASI_Rn01_00106011 predicted 1088
12 SASI_Rn01_00106017 predicted 1438
13 SASI_Rn01_00106019 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191483 predicted 1094
2 SASI_Mm01_00191484 predicted 616
3 SASI_Mm01_00191485 predicted 1025
4 SASI_Mm01_00191486 predicted 1441
5 SASI_Mm01_00191487 predicted 801
6 SASI_Mm01_00191488 predicted 931
7 SASI_Mm01_00191489 predicted 1436
8 SASI_Mm01_00191490 predicted 791
9 SASI_Mm01_00191491 predicted 1353
10 SASI_Mm02_00323678 predicted 1410
11 SASI_Mm01_00191492 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016873
VALIDATED
WISP2 MISSION shRNA Bacterial Glycerol Stock
WNT1 inducible signaling pathway protein 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000089383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-1196s1c1
Sequence:CCGGCCAGCTCCATTTCTCTGGATTCTCGAGAATCCAGAGAAATGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-301s1c1
Sequence:CCGGCTGCATTCTCTCAATGGTGTACTCGAGTACACCATTGAGAGAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-898s1c1
Sequence:CCGGCACCCGAGTATCCAACCAGAACTCGAGTTCTGGTTGGATACTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-303s1c1
Sequence:CCGGGCATTCTCTCAATGGTGTATTCTCGAGAATACACCATTGAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016873
VALIDATED
WISP2 MISSION shRNA shRNA Plasmid DNA
WNT1 inducible signaling pathway protein 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000089383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-1196s1c1
Sequence:CCGGCCAGCTCCATTTCTCTGGATTCTCGAGAATCCAGAGAAATGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-301s1c1
Sequence:CCGGCTGCATTCTCTCAATGGTGTACTCGAGTACACCATTGAGAGAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-898s1c1
Sequence:CCGGCACCCGAGTATCCAACCAGAACTCGAGTTCTGGTTGGATACTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-303s1c1
Sequence:CCGGGCATTCTCTCAATGGTGTATTCTCGAGAATACACCATTGAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016873
VALIDATED
WISP2 MISSION shRNA Lentiviral Transduction Particles
WNT1 inducible signaling pathway protein 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000089383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-1196s1c1
Sequence:CCGGCCAGCTCCATTTCTCTGGATTCTCGAGAATCCAGAGAAATGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-301s1c1
Sequence:CCGGCTGCATTCTCTCAATGGTGTACTCGAGTACACCATTGAGAGAATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-898s1c1
Sequence:CCGGCACCCGAGTATCCAACCAGAACTCGAGTTCTGGTTGGATACTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016873.1-303s1c1
Sequence:CCGGGCATTCTCTCAATGGTGTATTCTCGAGAATACACCATTGAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003881
WISP2 MISSION shRNA Bacterial Glycerol Stock
WNT1 inducible signaling pathway protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-194s1c1
Sequence:CCGGGCCTCCTCTCAAAGGTGCGTACTCGAGTACGCACCTTTGAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-728s1c1
Sequence:CCGGGCCCAGAATGGAGCACGGCCTCTCGAGAGGCCGTGCTCCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-335s1c1
Sequence:CCGGCCTGCGACCAACTCCACGTCTCTCGAGAGACGTGGAGTTGGTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-786s1c1
Sequence:CCGGCACCCGGGTGTCCAACCAGAACTCGAGTTCTGGTTGGACACCCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003881.2-218s21c1
Sequence:CCGGAGCTGTGCCCGACACCATGTACTCGAGTACATGGTGTCGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003881.2-689s21c1
Sequence:CCGGTTTCTGGCCTTGTCTCTTCCCCTCGAGGGGAAGAGACAAGGCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003881.2-1030s21c1
Sequence:CCGGCCATGCAGAACACCAATATTACTCGAGTAATATTGGTGTTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003881.2-1174s21c1
Sequence:CCGGCCTACACACACAGCCTATATCCTCGAGGATATAGGCTGTGTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003881
WISP2 MISSION shRNA shRNA Plasmid DNA
WNT1 inducible signaling pathway protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-194s1c1
Sequence:CCGGGCCTCCTCTCAAAGGTGCGTACTCGAGTACGCACCTTTGAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-728s1c1
Sequence:CCGGGCCCAGAATGGAGCACGGCCTCTCGAGAGGCCGTGCTCCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-335s1c1
Sequence:CCGGCCTGCGACCAACTCCACGTCTCTCGAGAGACGTGGAGTTGGTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-786s1c1
Sequence:CCGGCACCCGGGTGTCCAACCAGAACTCGAGTTCTGGTTGGACACCCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003881.2-218s21c1
Sequence:CCGGAGCTGTGCCCGACACCATGTACTCGAGTACATGGTGTCGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003881.2-689s21c1
Sequence:CCGGTTTCTGGCCTTGTCTCTTCCCCTCGAGGGGAAGAGACAAGGCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003881.2-1030s21c1
Sequence:CCGGCCATGCAGAACACCAATATTACTCGAGTAATATTGGTGTTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003881.2-1174s21c1
Sequence:CCGGCCTACACACACAGCCTATATCCTCGAGGATATAGGCTGTGTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003881
WISP2 MISSION shRNA Lentiviral Transduction Particles
WNT1 inducible signaling pathway protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-194s1c1
Sequence:CCGGGCCTCCTCTCAAAGGTGCGTACTCGAGTACGCACCTTTGAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-728s1c1
Sequence:CCGGGCCCAGAATGGAGCACGGCCTCTCGAGAGGCCGTGCTCCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-335s1c1
Sequence:CCGGCCTGCGACCAACTCCACGTCTCTCGAGAGACGTGGAGTTGGTCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003881.2-786s1c1
Sequence:CCGGCACCCGGGTGTCCAACCAGAACTCGAGTTCTGGTTGGACACCCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003881.2-218s21c1
Sequence:CCGGAGCTGTGCCCGACACCATGTACTCGAGTACATGGTGTCGGGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003881.2-689s21c1
Sequence:CCGGTTTCTGGCCTTGTCTCTTCCCCTCGAGGGGAAGAGACAAGGCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003881.2-1030s21c1
Sequence:CCGGCCATGCAGAACACCAATATTACTCGAGTAATATTGGTGTTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003881.2-1174s21c1
Sequence:CCGGCCTACACACACAGCCTATATCCTCGAGGATATAGGCTGTGTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks