EMAIL THIS PAGE TO A FRIEND

WISP3

WNT1 inducible signaling pathway protein 3

Synonyms: CCN6 LIBC PPAC PPD
UniProtKB ID: O95389, Q3KR29, Q5H8W4, Q6UXH6
Gene ID:
Human(8838) Summary: This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(327743) WNT1 inducible signaling pathway protein 3
Rat(499461) WNT1 inducible signaling pathway protein 3
domestic guinea pig(100727845) WNT1 inducible signaling pathway protein 3
naked mole-rat(101697161) WNT1 inducible signaling pathway protein 3
cow(100849041) WNT1 inducible signaling pathway protein 3
cow(784564) WNT1 inducible signaling pathway protein 3
sheep(101109099) WNT1 inducible signaling pathway protein 3
Zebrafish(794092) WNT1 inducible signaling pathway protein 3
chicken(770827) WNT1 inducible signaling pathway protein 3
Horse(100072430) WNT1 inducible signaling pathway protein 3
domestic cat(101086230) WNT1 inducible signaling pathway protein 3
dog(100686448) WNT1 inducible signaling pathway protein 3
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003880 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_282903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_282903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_282903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003880 Rosetta Predictions human pricing
NM_130396 Rosetta Predictions human pricing
NM_198239 Rosetta Predictions human pricing
XM_001062371 Rosetta Predictions rat pricing
XM_574785 Rosetta Predictions rat pricing
NM_001127376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336480 predicted 475
2 SASI_Hs02_00336481 predicted 446
3 SASI_Hs02_00336482 predicted 390
4 SASI_Hs02_00336483 predicted 457
5 SASI_Hs02_00336484 predicted 472
6 SASI_Hs02_00336485 predicted 467
7 SASI_Hs02_00336486 predicted 458
8 SASI_Hs02_00336487 predicted 433
9 SASI_Hs02_00336488 predicted 377
10 SASI_Hs02_00336489 predicted 366
11 SASI_Hs01_00021100 predicted 1020
12 SASI_Hs01_00021101 predicted 963
13 SASI_Hs01_00021102 predicted 959
14 SASI_Hs01_00021103 predicted 998
15 SASI_Hs01_00021104 predicted 1009
16 SASI_Hs01_00021105 predicted 1020
17 SASI_Hs01_00021106 predicted 962
18 SASI_Hs01_00021107 predicted 1015
19 SASI_Hs01_00021108 predicted 963
20 SASI_Hs01_00021109 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132094 predicted 840
2 SASI_Hs01_00132095 predicted 784
3 SASI_Hs01_00132096 predicted 784
4 SASI_Hs01_00132097 predicted 815
5 SASI_Hs01_00132098 predicted 832
6 SASI_Hs01_00132099 predicted 841
7 SASI_Hs01_00132100 predicted 790
8 SASI_Hs01_00132101 predicted 841
9 SASI_Hs01_00132102 predicted 785
10 SASI_Hs01_00132103 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371764 predicted 555
2 SASI_Hs02_00371765 predicted 523
3 SASI_Hs02_00371766 predicted 474
4 SASI_Hs02_00371767 predicted 541
5 SASI_Hs02_00371768 predicted 556
6 SASI_Hs02_00371769 predicted 545
7 SASI_Hs02_00371770 predicted 536
8 SASI_Hs02_00371771 predicted 514
9 SASI_Hs02_00371772 predicted 455
10 SASI_Hs02_00371773 predicted 442
11 SASI_Hs01_00015139 predicted 1103
12 SASI_Hs01_00015140 predicted 1044
13 SASI_Hs01_00015141 predicted 1039
14 SASI_Hs01_00015142 predicted 1072
15 SASI_Hs01_00015143 predicted 1095
16 SASI_Hs01_00015144 predicted 1098
17 SASI_Hs01_00015145 predicted 1045
18 SASI_Hs01_00015146 predicted 1096
19 SASI_Hs01_00015147 predicted 1036
20 SASI_Hs01_00015148 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303261 predicted 1139
2 SASI_Rn02_00303262 predicted 1224
3 SASI_Rn02_00303263 predicted 1098
4 SASI_Rn02_00303264 predicted 1235
5 SASI_Rn02_00303265 predicted 877
6 SASI_Rn02_00303266 predicted 1210
7 SASI_Rn02_00303267 predicted 1043
8 SASI_Rn02_00303268 predicted 1273
9 SASI_Rn02_00303269 predicted 1267
10 SASI_Rn02_00303270 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402612 predicted 290
2 SASI_Rn02_00402613 predicted 244
3 SASI_Rn02_00402614 predicted 303
4 SASI_Rn02_00402615 predicted 427
5 SASI_Rn02_00402616 predicted 419
6 SASI_Rn02_00402617 predicted 259
7 SASI_Rn02_00402618 predicted 238
8 SASI_Rn02_00402619 predicted 439
9 SASI_Rn02_00402620 predicted 261
10 SASI_Rn02_00402621 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310358 predicted 937
2 SASI_Mm02_00310359 predicted 476
3 SASI_Mm02_00310360 predicted 636
4 SASI_Mm02_00310361 predicted 809
5 SASI_Mm02_00310362 predicted 494
6 SASI_Mm02_00310363 predicted 1021
7 SASI_Mm02_00310364 predicted 711
8 SASI_Mm02_00310365 predicted 1193
9 SASI_Mm02_00310366 predicted 368
10 SASI_Mm02_00310367 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003880
WISP3 MISSION shRNA Bacterial Glycerol Stock
WNT1 inducible signaling pathway protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003880.3-703s21c1
Sequence:CCGGATAGAAATCTCCCACTTATTTCTCGAGAAATAAGTGGGAGATTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003880.3-226s21c1
Sequence:CCGGCAGATGCACCTCAGCGTAAACCTCGAGGTTTACGCTGAGGTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003880.3-967s21c1
Sequence:CCGGCAAGTACTCAGAGTTACAAACCTCGAGGTTTGTAACTCTGAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-668s1c1
Sequence:CCGGGCAGCTTTCAACAAGCTACAACTCGAGTTGTAGCTTGTTGAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-1007s1c1
Sequence:CCGGCTTGGATAAGAGATGCTGTATCTCGAGATACAGCATCTCTTATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-1132s1c1
Sequence:CCGGGCAGAGAACCTGGAGATATATCTCGAGATATATCTCCAGGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-475s1c1
Sequence:CCGGGCGAGTTCAACCAGGTACATTCTCGAGAATGTACCTGGTTGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-186s1c1
Sequence:CCGGCCATTAGATACAACACCTGAACTCGAGTTCAGGTGTTGTATCTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003880
WISP3 MISSION shRNA shRNA Plasmid DNA
WNT1 inducible signaling pathway protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003880.3-703s21c1
Sequence:CCGGATAGAAATCTCCCACTTATTTCTCGAGAAATAAGTGGGAGATTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003880.3-226s21c1
Sequence:CCGGCAGATGCACCTCAGCGTAAACCTCGAGGTTTACGCTGAGGTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003880.3-967s21c1
Sequence:CCGGCAAGTACTCAGAGTTACAAACCTCGAGGTTTGTAACTCTGAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-668s1c1
Sequence:CCGGGCAGCTTTCAACAAGCTACAACTCGAGTTGTAGCTTGTTGAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-1007s1c1
Sequence:CCGGCTTGGATAAGAGATGCTGTATCTCGAGATACAGCATCTCTTATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-1132s1c1
Sequence:CCGGGCAGAGAACCTGGAGATATATCTCGAGATATATCTCCAGGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-475s1c1
Sequence:CCGGGCGAGTTCAACCAGGTACATTCTCGAGAATGTACCTGGTTGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-186s1c1
Sequence:CCGGCCATTAGATACAACACCTGAACTCGAGTTCAGGTGTTGTATCTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003880
WISP3 MISSION shRNA Lentiviral Transduction Particles
WNT1 inducible signaling pathway protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003880.3-703s21c1
Sequence:CCGGATAGAAATCTCCCACTTATTTCTCGAGAAATAAGTGGGAGATTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003880.3-226s21c1
Sequence:CCGGCAGATGCACCTCAGCGTAAACCTCGAGGTTTACGCTGAGGTGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003880.3-967s21c1
Sequence:CCGGCAAGTACTCAGAGTTACAAACCTCGAGGTTTGTAACTCTGAGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-668s1c1
Sequence:CCGGGCAGCTTTCAACAAGCTACAACTCGAGTTGTAGCTTGTTGAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-1007s1c1
Sequence:CCGGCTTGGATAAGAGATGCTGTATCTCGAGATACAGCATCTCTTATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-1132s1c1
Sequence:CCGGGCAGAGAACCTGGAGATATATCTCGAGATATATCTCCAGGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-475s1c1
Sequence:CCGGGCGAGTTCAACCAGGTACATTCTCGAGAATGTACCTGGTTGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003880.2-186s1c1
Sequence:CCGGCCATTAGATACAACACCTGAACTCGAGTTCAGGTGTTGTATCTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_282903
WISP3 MISSION shRNA Bacterial Glycerol Stock
WNT1 inducible signaling pathway protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-108s1c1
Sequence:CCGGCGGCTGGAACATTGACCCGTTCTCGAGAACGGGTCAATGTTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-37s1c1
Sequence:CCGGAGATCAATAATGCAAGGCTCTCTCGAGAGAGCCTTGCATTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-800s1c1
Sequence:CCGGGTTCTGCAGCTAAAGGAAGAACTCGAGTTCTTCCTTTAGCTGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-144s1c1
Sequence:CCGGCACCAGGAAGTCCAGTGAAATCTCGAGATTTCACTGGACTTCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-671s1c1
Sequence:CCGGGTGAGTTCAACAGGGTCTATTCTCGAGAATAGACCCTGTTGAACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_282903
WISP3 MISSION shRNA shRNA Plasmid DNA
WNT1 inducible signaling pathway protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-108s1c1
Sequence:CCGGCGGCTGGAACATTGACCCGTTCTCGAGAACGGGTCAATGTTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-37s1c1
Sequence:CCGGAGATCAATAATGCAAGGCTCTCTCGAGAGAGCCTTGCATTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-800s1c1
Sequence:CCGGGTTCTGCAGCTAAAGGAAGAACTCGAGTTCTTCCTTTAGCTGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-144s1c1
Sequence:CCGGCACCAGGAAGTCCAGTGAAATCTCGAGATTTCACTGGACTTCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-671s1c1
Sequence:CCGGGTGAGTTCAACAGGGTCTATTCTCGAGAATAGACCCTGTTGAACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_282903
WISP3 MISSION shRNA Lentiviral Transduction Particles
WNT1 inducible signaling pathway protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-108s1c1
Sequence:CCGGCGGCTGGAACATTGACCCGTTCTCGAGAACGGGTCAATGTTCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-37s1c1
Sequence:CCGGAGATCAATAATGCAAGGCTCTCTCGAGAGAGCCTTGCATTATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-800s1c1
Sequence:CCGGGTTCTGCAGCTAAAGGAAGAACTCGAGTTCTTCCTTTAGCTGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-144s1c1
Sequence:CCGGCACCAGGAAGTCCAGTGAAATCTCGAGATTTCACTGGACTTCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_282903.3-671s1c1
Sequence:CCGGGTGAGTTCAACAGGGTCTATTCTCGAGAATAGACCCTGTTGAACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks