EMAIL THIS PAGE TO A FRIEND

WIZ

widely interspaced zinc finger motifs

Synonyms: ZNF803
Gene ID:
Mouse(22404) widely-interspaced zinc finger motifs
Rat(314598) widely-interspaced zinc finger motifs
chicken(426166) widely interspaced zinc finger motifs
chicken(100858129) widely interspaced zinc finger motifs
dog(476682) widely interspaced zinc finger motifs
Horse(100063247) widely interspaced zinc finger motifs
domestic cat(101088989) widely interspaced zinc finger motifs
cow(535200) widely interspaced zinc finger motifs
sheep(101123038) widely interspaced zinc finger motifs
naked mole-rat(101724446) widely interspaced zinc finger motifs
domestic guinea pig(100717698) widely interspaced zinc finger motifs
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021241 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021241 Rosetta Predictions human pricing
XM_372716 Rosetta Predictions human pricing
XM_930438 Rosetta Predictions human pricing
XM_934813 Rosetta Predictions human pricing
XM_934815 Rosetta Predictions human pricing
XM_934817 Rosetta Predictions human pricing
NM_001108064 Rosetta Predictions rat pricing
NM_011717 Rosetta Predictions mouse pricing
NM_212438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354883 predicted 762
2 SASI_Hs02_00354884 predicted 1839
3 SASI_Hs02_00354885 predicted 1107
4 SASI_Hs02_00354886 predicted 777
5 SASI_Hs02_00354887 predicted 3071
6 SASI_Hs02_00354888 predicted 1945
7 SASI_Hs02_00354889 predicted 1314
8 SASI_Hs02_00354890 predicted 1782
9 SASI_Hs02_00354891 predicted 1920
10 SASI_Hs02_00354892 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258110 predicted 1447
2 SASI_Hs01_00258111 predicted 822
3 SASI_Hs01_00258112 predicted 1888
4 SASI_Hs01_00258113 predicted 1162
5 SASI_Hs01_00258114 predicted 835
6 SASI_Hs01_00258115 predicted 1365
7 SASI_Hs01_00258116 predicted 1845
8 SASI_Hs01_00258117 predicted 1982
9 SASI_Hs01_00258118 predicted 2990
10 SASI_Hs01_00258119 predicted 2309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263709 predicted 1753
2 SASI_Hs01_00263710 predicted 1391
3 SASI_Hs01_00263711 predicted 760
4 SASI_Hs01_00263712 predicted 1834
5 SASI_Hs01_00263713 predicted 1109
6 SASI_Hs01_00263714 predicted 782
7 SASI_Hs01_00263715 predicted 1306
8 SASI_Hs01_00263716 predicted 1783
9 SASI_Hs01_00263717 predicted 1926
10 SASI_Hs01_00263718 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292863 predicted 371
2 SASI_Hs01_00292864 predicted 439
3 SASI_Hs01_00292865 predicted 307
4 SASI_Hs01_00292866 predicted 271
5 SASI_Hs01_00292867 predicted 368
6 SASI_Hs01_00292868 predicted 484
7 SASI_Hs01_00292869 predicted 438
8 SASI_Hs01_00292870 predicted 311
9 SASI_Hs01_00292871 predicted 483
10 SASI_Hs01_00292872 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261923 predicted 696
2 SASI_Hs01_00261924 predicted 1042
3 SASI_Hs01_00261925 predicted 708
4 SASI_Hs01_00261926 predicted 300
5 SASI_Hs01_00261927 predicted 272
6 SASI_Hs01_00261928 predicted 1244
7 SASI_Hs01_00261929 predicted 1720
8 SASI_Hs01_00261930 predicted 1851
9 SASI_Hs01_00261931 predicted 439
10 SASI_Hs01_00261932 predicted 2859
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273073 predicted 1139
2 SASI_Hs01_00273074 predicted 773
3 SASI_Hs01_00273075 predicted 1143
4 SASI_Hs01_00273076 predicted 1224
5 SASI_Hs01_00273077 predicted 498
6 SASI_Hs01_00273078 predicted 696
7 SASI_Hs01_00273079 predicted 1174
8 SASI_Hs01_00273080 predicted 1306
9 SASI_Hs01_00273081 predicted 1777
10 SASI_Hs01_00273082 predicted 2322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234995 predicted 1549
2 SASI_Rn02_00234996 predicted 2364
3 SASI_Rn02_00234997 predicted 290
4 SASI_Rn02_00234998 predicted 2686
5 SASI_Rn02_00234999 predicted 1569
6 SASI_Rn02_00235000 predicted 1152
7 SASI_Rn02_00235001 predicted 432
8 SASI_Rn02_00235002 predicted 1412
9 SASI_Rn02_00235003 predicted 1652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072986 predicted 2581
2 SASI_Mm01_00072987 predicted 1763
3 SASI_Mm01_00072988 predicted 1364
4 SASI_Mm01_00072989 predicted 1634
5 SASI_Mm01_00072990 predicted 1922
6 SASI_Mm01_00072991 predicted 1879
7 SASI_Mm01_00072992 predicted 2018
8 SASI_Mm01_00072993 predicted 2838
9 SASI_Mm01_00072994 predicted 3012
10 SASI_Mm01_00072995 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070613 predicted 2698
2 SASI_Mm01_00070614 predicted 1887
3 SASI_Mm01_00070615 predicted 1483
4 SASI_Mm01_00070616 predicted 1751
5 SASI_Mm01_00070617 predicted 2036
6 SASI_Mm01_00070618 predicted 1999
7 SASI_Mm01_00070619 predicted 2142
8 SASI_Mm01_00070620 predicted 2959
9 SASI_Mm01_00070621 predicted 3131
10 SASI_Mm01_00070622 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212438
VALIDATED
WIZ MISSION shRNA Bacterial Glycerol Stock
widely interspaced zinc finger motifs
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212438.1-4096s1c1
Sequence:CCGGGCTCCCTAGATCTTTCACTTTCTCGAGAAAGTGAAAGATCTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212438.1-1515s1c1
Sequence:CCGGCTGTGGTGAGTTCTTTGAGAACTCGAGTTCTCAAAGAACTCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212438.1-1760s1c1
Sequence:CCGGCTGATCTTCACATCTCACCTTCTCGAGAAGGTGAGATGTGAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212438.1-778s1c1
Sequence:CCGGCCTGGGCCAATCTACGGAGATCTCGAGATCTCCGTAGATTGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212438.1-3164s1c1
Sequence:CCGGGCAGGTTCTGTGAAGTGGAATCTCGAGATTCCACTTCACAGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-3164s21c1
Sequence:CCGGGCAGGTTCTGTGAAGTGGAATCTCGAGATTCCACTTCACAGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-3208s21c1
Sequence:CCGGGAAGAGTGGGTACGGCATTTACTCGAGTAAATGCCGTACCCACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-1760s21c1
Sequence:CCGGCTGATCTTCACATCTCACCTTCTCGAGAAGGTGAGATGTGAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-4096s21c1
Sequence:CCGGGCTCCCTAGATCTTTCACTTTCTCGAGAAAGTGAAAGATCTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-1515s21c1
Sequence:CCGGCTGTGGTGAGTTCTTTGAGAACTCGAGTTCTCAAAGAACTCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212438
VALIDATED
WIZ MISSION shRNA shRNA Plasmid DNA
widely interspaced zinc finger motifs
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212438.1-4096s1c1
Sequence:CCGGGCTCCCTAGATCTTTCACTTTCTCGAGAAAGTGAAAGATCTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212438.1-1515s1c1
Sequence:CCGGCTGTGGTGAGTTCTTTGAGAACTCGAGTTCTCAAAGAACTCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212438.1-1760s1c1
Sequence:CCGGCTGATCTTCACATCTCACCTTCTCGAGAAGGTGAGATGTGAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212438.1-778s1c1
Sequence:CCGGCCTGGGCCAATCTACGGAGATCTCGAGATCTCCGTAGATTGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212438.1-3164s1c1
Sequence:CCGGGCAGGTTCTGTGAAGTGGAATCTCGAGATTCCACTTCACAGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-3164s21c1
Sequence:CCGGGCAGGTTCTGTGAAGTGGAATCTCGAGATTCCACTTCACAGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-3208s21c1
Sequence:CCGGGAAGAGTGGGTACGGCATTTACTCGAGTAAATGCCGTACCCACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-1760s21c1
Sequence:CCGGCTGATCTTCACATCTCACCTTCTCGAGAAGGTGAGATGTGAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-4096s21c1
Sequence:CCGGGCTCCCTAGATCTTTCACTTTCTCGAGAAAGTGAAAGATCTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-1515s21c1
Sequence:CCGGCTGTGGTGAGTTCTTTGAGAACTCGAGTTCTCAAAGAACTCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212438
VALIDATED
WIZ MISSION shRNA Lentiviral Transduction Particles
widely interspaced zinc finger motifs
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212438.1-4096s1c1
Sequence:CCGGGCTCCCTAGATCTTTCACTTTCTCGAGAAAGTGAAAGATCTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212438.1-1515s1c1
Sequence:CCGGCTGTGGTGAGTTCTTTGAGAACTCGAGTTCTCAAAGAACTCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_212438.1-1760s1c1
Sequence:CCGGCTGATCTTCACATCTCACCTTCTCGAGAAGGTGAGATGTGAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212438.1-778s1c1
Sequence:CCGGCCTGGGCCAATCTACGGAGATCTCGAGATCTCCGTAGATTGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212438.1-3164s1c1
Sequence:CCGGGCAGGTTCTGTGAAGTGGAATCTCGAGATTCCACTTCACAGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-3164s21c1
Sequence:CCGGGCAGGTTCTGTGAAGTGGAATCTCGAGATTCCACTTCACAGAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-3208s21c1
Sequence:CCGGGAAGAGTGGGTACGGCATTTACTCGAGTAAATGCCGTACCCACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-1760s21c1
Sequence:CCGGCTGATCTTCACATCTCACCTTCTCGAGAAGGTGAGATGTGAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-4096s21c1
Sequence:CCGGGCTCCCTAGATCTTTCACTTTCTCGAGAAAGTGAAAGATCTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_212438.1-1515s21c1
Sequence:CCGGCTGTGGTGAGTTCTTTGAGAACTCGAGTTCTCAAAGAACTCACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021241
WIZ MISSION shRNA Bacterial Glycerol Stock
widely interspaced zinc finger motifs
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-411s21c1
Sequence:CCGGGCATCTCTGTGGCCAACTTTGCTCGAGCAAAGTTGGCCACAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-2226s21c1
Sequence:CCGGAGCGGCAGAACATCAACAAATCTCGAGATTTGTTGATGTTCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021241.2-3175s21c1
Sequence:CCGGAGCCCACAATGCCACGGAAATCTCGAGATTTCCGTGGCATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-2415s21c1
Sequence:CCGGGCAACATCTACACCCTCAAATCTCGAGATTTGAGGGTGTAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-855s21c1
Sequence:CCGGTGACCGAGTGGTACGTCAATGCTCGAGCATTGACGTACCACTCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021241
WIZ MISSION shRNA shRNA Plasmid DNA
widely interspaced zinc finger motifs
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-411s21c1
Sequence:CCGGGCATCTCTGTGGCCAACTTTGCTCGAGCAAAGTTGGCCACAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-2226s21c1
Sequence:CCGGAGCGGCAGAACATCAACAAATCTCGAGATTTGTTGATGTTCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021241.2-3175s21c1
Sequence:CCGGAGCCCACAATGCCACGGAAATCTCGAGATTTCCGTGGCATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-2415s21c1
Sequence:CCGGGCAACATCTACACCCTCAAATCTCGAGATTTGAGGGTGTAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-855s21c1
Sequence:CCGGTGACCGAGTGGTACGTCAATGCTCGAGCATTGACGTACCACTCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021241
WIZ MISSION shRNA Lentiviral Transduction Particles
widely interspaced zinc finger motifs
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-411s21c1
Sequence:CCGGGCATCTCTGTGGCCAACTTTGCTCGAGCAAAGTTGGCCACAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-2226s21c1
Sequence:CCGGAGCGGCAGAACATCAACAAATCTCGAGATTTGTTGATGTTCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021241.2-3175s21c1
Sequence:CCGGAGCCCACAATGCCACGGAAATCTCGAGATTTCCGTGGCATTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-2415s21c1
Sequence:CCGGGCAACATCTACACCCTCAAATCTCGAGATTTGAGGGTGTAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021241.2-855s21c1
Sequence:CCGGTGACCGAGTGGTACGTCAATGCTCGAGCATTGACGTACCACTCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks