EMAIL THIS PAGE TO A FRIEND

WLS

wntless homolog (Drosophila)

Synonyms: C1orf139 EVI GPR177 MRP mig-14
UniProtKB ID: Q5T9L3, B2RNT2, Q5JRS7, Q7Z2Z9, Q8NC43
Gene ID:
Mouse(68151) wntless homolog (Drosophila)
Rat(362065) wntless homolog (Drosophila)
chicken(424707) wntless homolog (Drosophila)
dog(611491) wntless homolog (Drosophila)
Horse(100053710) wntless homolog (Drosophila)
domestic cat(101089632) wntless homolog (Drosophila)
Zebrafish(406420) wntless homolog (Drosophila)
cow(528123) wntless homolog (Drosophila)
sheep(101116103) wntless homolog (Drosophila)
domestic guinea pig(100719180) wntless homolog (Drosophila)
naked mole-rat(101724507) wntless homolog (Drosophila)
Domestic Rabbit(100352518) wntless homolog (Drosophila)
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108584 Anti-GPR177 affinity isolated antibody canine, guinea pig, human, horse, mouse, rat, pig, rabbit, bovine
immunohistochemistry, western blot pricing
AV44430 Anti-GPR177 antibody produced in rabbit affinity isolated antibody bovine, rat, human, mouse, canine
immunohistochemistry, western blot pricing
SAB2100959 Anti-GPR177 antibody produced in rabbit affinity isolated antibody mouse, zebrafish, horse, rat, bovine, canine, human, guinea pig, rabbit
western blot pricing
HPA069520 Anti-WLS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024911 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002292 Rosetta Predictions human pricing
NM_024911 Rosetta Predictions human pricing
NM_001085353 Rosetta Predictions rat pricing
NM_199408 Rosetta Predictions rat pricing
XM_579734 Rosetta Predictions rat pricing
NM_026582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081559 predicted 784
2 SASI_Hs01_00081561 predicted 1550
3 SASI_Hs01_00081562 predicted 1155
4 SASI_Hs02_00304182 predicted 987
5 SASI_Hs01_00081563 predicted 1064
6 SASI_Hs01_00081564 predicted 1082
7 SASI_Hs01_00081565 predicted 618
8 SASI_Hs01_00081566 predicted 1548
9 SASI_Hs01_00081567 predicted 1090
10 SASI_Hs01_00081568 predicted 620
11 SASI_Hs01_00081560 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233756 predicted 791
2 SASI_Hs01_00233757 predicted 1561
3 SASI_Hs01_00233758 predicted 1154
4 SASI_Hs01_00233759 predicted 1000
5 SASI_Hs01_00233760 predicted 1071
6 SASI_Hs01_00233761 predicted 1084
7 SASI_Hs01_00233762 predicted 633
8 SASI_Hs01_00233763 predicted 1557
9 SASI_Hs01_00233764 predicted 1095
10 SASI_Hs01_00233765 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208969 predicted 633
2 SASI_Rn02_00208970 predicted 1067
3 SASI_Rn02_00208971 predicted 1195
4 SASI_Rn02_00208972 predicted 1164
5 SASI_Rn02_00208973 predicted 374
6 SASI_Rn02_00208974 predicted 1147
7 SASI_Rn02_00208975 predicted 1282
8 SASI_Rn02_00208976 predicted 865
9 SASI_Rn02_00208977 predicted 1464
10 SASI_Rn02_00208978 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035885 predicted 643
2 SASI_Rn01_00035886 predicted 1075
3 SASI_Rn01_00035888 predicted 1205
4 SASI_Rn01_00035889 predicted 1168
5 SASI_Rn02_00270236 predicted 384
6 SASI_Rn01_00035891 predicted 1156
7 SASI_Rn01_00035892 predicted 1285
8 SASI_Rn01_00035893 predicted 869
9 SASI_Rn02_00270237 predicted 1472
10 SASI_Rn02_00270238 predicted 545
11 SASI_Rn01_00035887 predicted 871
12 SASI_Rn01_00035890 predicted 762
13 SASI_Rn01_00035894 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196746 predicted 1270
2 SASI_Rn01_00196747 predicted 646
3 SASI_Rn01_00196748 predicted 1083
4 SASI_Rn01_00196749 predicted 868
5 SASI_Rn01_00196750 predicted 1204
6 SASI_Rn01_00196751 predicted 1181
7 SASI_Rn01_00196752 predicted 758
8 SASI_Rn01_00196753 predicted 1160
9 SASI_Rn01_00196754 predicted 1291
10 SASI_Rn01_00196755 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156804 predicted 1215
2 SASI_Mm02_00330548 predicted 1960
3 SASI_Mm02_00330549 predicted 1923
4 SASI_Mm01_00156805 predicted 701
5 SASI_Mm01_00156806 predicted 1891
6 SASI_Mm01_00156807 predicted 1137
7 SASI_Mm01_00156809 predicted 1850
8 SASI_Mm01_00156810 predicted 949
9 SASI_Mm01_00156811 predicted 1264
10 SASI_Mm01_00156812 predicted 1596
11 SASI_Mm01_00156808 predicted 972
12 SASI_Mm01_00156813 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026582
WLS MISSION shRNA Bacterial Glycerol Stock
wntless homolog (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-404s21c1
Sequence:CCGGGTCCGTAAGAACCACCATAAACTCGAGTTTATGGTGGTTCTTACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-758s21c1
Sequence:CCGGGAGCACGAAGGTCGTTATTATCTCGAGATAATAACGACCTTCGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-1794s21c1
Sequence:CCGGTGCAGCTTACTACCACTATAACTCGAGTTATAGTGGTAGTAAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026582.3-1972s21c1
Sequence:CCGGCCTAGTGCTTCTTAGGTATAGCTCGAGCTATACCTAAGAAGCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-373s21c1
Sequence:CCGGAGTACCCTACACGGCAATAAACTCGAGTTTATTGCCGTGTAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026582
WLS MISSION shRNA shRNA Plasmid DNA
wntless homolog (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-404s21c1
Sequence:CCGGGTCCGTAAGAACCACCATAAACTCGAGTTTATGGTGGTTCTTACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-758s21c1
Sequence:CCGGGAGCACGAAGGTCGTTATTATCTCGAGATAATAACGACCTTCGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-1794s21c1
Sequence:CCGGTGCAGCTTACTACCACTATAACTCGAGTTATAGTGGTAGTAAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026582.3-1972s21c1
Sequence:CCGGCCTAGTGCTTCTTAGGTATAGCTCGAGCTATACCTAAGAAGCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-373s21c1
Sequence:CCGGAGTACCCTACACGGCAATAAACTCGAGTTTATTGCCGTGTAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026582
WLS MISSION shRNA Lentiviral Transduction Particles
wntless homolog (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-404s21c1
Sequence:CCGGGTCCGTAAGAACCACCATAAACTCGAGTTTATGGTGGTTCTTACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-758s21c1
Sequence:CCGGGAGCACGAAGGTCGTTATTATCTCGAGATAATAACGACCTTCGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-1794s21c1
Sequence:CCGGTGCAGCTTACTACCACTATAACTCGAGTTATAGTGGTAGTAAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026582.3-1972s21c1
Sequence:CCGGCCTAGTGCTTCTTAGGTATAGCTCGAGCTATACCTAAGAAGCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026582.3-373s21c1
Sequence:CCGGAGTACCCTACACGGCAATAAACTCGAGTTTATTGCCGTGTAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024911
VALIDATED
WLS MISSION shRNA Bacterial Glycerol Stock
wntless homolog (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-1814s1c1
Sequence:CCGGGATCTACAAGTTGACCCGCAACTCGAGTTGCGGGTCAACTTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-480s1c1
Sequence:CCGGGAAGCTAATGACATCGTGTTTCTCGAGAAACACGATGTCATTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-1265s1c1
Sequence:CCGGCTGCCTCTTCATATTTGACATCTCGAGATGTCAAATATGAAGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-827s1c1
Sequence:CCGGGCCTGTGAATGAGAAGAAGAACTCGAGTTCTTCTTCTCATTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024911.3-1029s1c1
Sequence:CCGGGTCATCTTTGCCCTTGGGATTCTCGAGAATCCCAAGGGCAAAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-680s1c1
Sequence:CCGGCCATGAAAGAGTACCACGGAACTCGAGTTCCGTGGTACTCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_024911.3-1364s1c1
Sequence:CCGGCTTCATCATCGTGGCTGGAATCTCGAGATTCCAGCCACGATGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024911.3-1433s1c1
Sequence:CCGGGTTTCGGAACATCAGTGGGAACTCGAGTTCCCACTGATGTTCCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024911.3-977s1c1
Sequence:CCGGGTATTGGAGGAGGATCACCATCTCGAGATGGTGATCCTCCTCCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024911
VALIDATED
WLS MISSION shRNA shRNA Plasmid DNA
wntless homolog (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-1814s1c1
Sequence:CCGGGATCTACAAGTTGACCCGCAACTCGAGTTGCGGGTCAACTTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-480s1c1
Sequence:CCGGGAAGCTAATGACATCGTGTTTCTCGAGAAACACGATGTCATTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-1265s1c1
Sequence:CCGGCTGCCTCTTCATATTTGACATCTCGAGATGTCAAATATGAAGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-827s1c1
Sequence:CCGGGCCTGTGAATGAGAAGAAGAACTCGAGTTCTTCTTCTCATTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024911.3-1029s1c1
Sequence:CCGGGTCATCTTTGCCCTTGGGATTCTCGAGAATCCCAAGGGCAAAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-680s1c1
Sequence:CCGGCCATGAAAGAGTACCACGGAACTCGAGTTCCGTGGTACTCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_024911.3-1364s1c1
Sequence:CCGGCTTCATCATCGTGGCTGGAATCTCGAGATTCCAGCCACGATGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024911.3-1433s1c1
Sequence:CCGGGTTTCGGAACATCAGTGGGAACTCGAGTTCCCACTGATGTTCCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024911.3-977s1c1
Sequence:CCGGGTATTGGAGGAGGATCACCATCTCGAGATGGTGATCCTCCTCCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024911
VALIDATED
WLS MISSION shRNA Lentiviral Transduction Particles
wntless homolog (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-1814s1c1
Sequence:CCGGGATCTACAAGTTGACCCGCAACTCGAGTTGCGGGTCAACTTGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-480s1c1
Sequence:CCGGGAAGCTAATGACATCGTGTTTCTCGAGAAACACGATGTCATTAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-1265s1c1
Sequence:CCGGCTGCCTCTTCATATTTGACATCTCGAGATGTCAAATATGAAGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-827s1c1
Sequence:CCGGGCCTGTGAATGAGAAGAAGAACTCGAGTTCTTCTTCTCATTCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024911.3-1029s1c1
Sequence:CCGGGTCATCTTTGCCCTTGGGATTCTCGAGAATCCCAAGGGCAAAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024911.3-680s1c1
Sequence:CCGGCCATGAAAGAGTACCACGGAACTCGAGTTCCGTGGTACTCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_024911.3-1364s1c1
Sequence:CCGGCTTCATCATCGTGGCTGGAATCTCGAGATTCCAGCCACGATGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024911.3-1433s1c1
Sequence:CCGGGTTTCGGAACATCAGTGGGAACTCGAGTTCCCACTGATGTTCCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024911.3-977s1c1
Sequence:CCGGGTATTGGAGGAGGATCACCATCTCGAGATGGTGATCCTCCTCCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks