EMAIL THIS PAGE TO A FRIEND

WNK1

WNK lysine deficient protein kinase 1

Synonyms: HSAN2 HSN2 KDP PRKWNK1 PSK p65
Gene ID:
Human(65125) Summary: This gene encodes a member of the WNK subfamily of serine/threonine protein kinases. The encoded protein may be a key regulator of blood pressure by controlling the transport of sodium and chloride ions. Mutations in this gene have been associated with pseudohypoaldosteronism type II and hereditary sensory neuropathy type II. Alternatively spliced transcript variants encoding different isoforms have been described but the full-length nature of all of them has yet to be determined.[provided by RefSeq, May 2010]
Mouse(232341) WNK lysine deficient protein kinase 1
Rat(116477) WNK lysine deficient protein kinase 1
Thale Cress(819651) serine/threonine-protein kinase WNK1
chicken(427925) WNK lysine deficient protein kinase 1
dog(477728) WNK lysine deficient protein kinase 1
Horse(100056745) WNK lysine deficient protein kinase 1
domestic cat(101096818) WNK lysine deficient protein kinase 1
cow(506433) WNK lysine deficient protein kinase 1
sheep(101115533) WNK lysine deficient protein kinase 1
Domestic Rabbit(100350906) WNK lysine deficient protein kinase 1
naked mole-rat(101703182) WNK lysine deficient protein kinase 1
domestic guinea pig(100729855) WNK lysine deficient protein kinase 1
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503840 Anti-phospho-WNK1 (pThr58) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB2900174 Anti-PRKWNK1 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, monkey, bovine, pig, horse, rat, rabbit, human, chicken, hamster
ELISA, immunohistochemistry pricing
SAB2900175 Anti-PRKWNK1 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB1300464 Anti-WNK1 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1300465 Anti-WNK1 (center) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, western blot pricing
HPA059157 Anti-WNK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1411284 Anti-WNK1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA046541 Anti-WNK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4502802 Anti-WNK1, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018979 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018979 siRNAs that have been validated in the lab human pricing
NM_053794 Rosetta Predictions rat pricing
NM_198703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018979 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092577 validated 6950
1 SASI_Hs01_00092579 validated 6185
1 SASI_Hs01_00092578 validated 5399
2 SASI_Hs02_00352474 predicted 7737
3 SASI_Hs02_00352475 predicted 7730
4 SASI_Hs01_00092580 predicted 1253
5 SASI_Hs01_00092581 predicted 4822
6 SASI_Hs01_00092583 predicted 6668
7 SASI_Hs01_00092584 predicted 2931
8 SASI_Hs01_00092586 predicted 1692
9 SASI_Hs02_00352476 predicted 6236
10 SASI_Hs01_00092582 predicted 4223
11 SASI_Hs01_00092585 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118344 predicted 1659
2 SASI_Rn01_00118345 predicted 6634
3 SASI_Rn01_00118347 predicted 989
4 SASI_Rn02_00266601 predicted 1157
5 SASI_Rn01_00118348 predicted 5115
6 SASI_Rn02_00266602 predicted 2570
7 SASI_Rn01_00118349 predicted 1353
8 SASI_Rn01_00118350 predicted 2798
9 SASI_Rn01_00118351 predicted 4322
10 SASI_Rn02_00266603 predicted 902
11 SASI_Rn01_00118346 predicted 6627
12 SASI_Rn01_00118352 predicted 1455
13 SASI_Rn01_00118353 predicted 3047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074066 predicted 1434
2 SASI_Mm01_00074067 predicted 6838
3 SASI_Mm01_00074068 predicted 5237
4 SASI_Mm01_00074069 predicted 2060
5 SASI_Mm01_00074070 predicted 5059
6 SASI_Mm01_00074072 predicted 3853
7 SASI_Mm01_00074074 predicted 887
8 SASI_Mm01_00074075 predicted 3533
9 SASI_Mm02_00351158 predicted 3771
10 SASI_Mm02_00351159 predicted 4199
11 SASI_Mm01_00074071 predicted 5866
12 SASI_Mm01_00074073 predicted 3815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198703
VALIDATED
WNK1 MISSION shRNA Bacterial Glycerol Stock
WNK lysine deficient protein kinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-4187s1c1
Sequence:CCGGCGTCAGTATCAGTCCCTATAACTCGAGTTATAGGGACTGATACTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198703.1-1656s1c1
Sequence:CCGGGCTGCGTATTGAAGATATTAACTCGAGTTAATATCTTCAATACGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-6146s1c1
Sequence:CCGGCCCATTTGAATGGGCCATCTTCTCGAGAAGATGGCCCATTCAAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-2079s1c1
Sequence:CCGGGCAACCTAGTATATCTGTGTTCTCGAGAACACAGATATACTAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-6257s1c1
Sequence:CCGGCCGTCCAGAATCTAAGTCAAACTCGAGTTTGACTTAGATTCTGGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-6257s21c1
Sequence:CCGGCCGTCCAGAATCTAAGTCAAACTCGAGTTTGACTTAGATTCTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-2079s21c1
Sequence:CCGGGCAACCTAGTATATCTGTGTTCTCGAGAACACAGATATACTAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-1656s21c1
Sequence:CCGGGCTGCGTATTGAAGATATTAACTCGAGTTAATATCTTCAATACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-6146s21c1
Sequence:CCGGCCCATTTGAATGGGCCATCTTCTCGAGAAGATGGCCCATTCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-4187s21c1
Sequence:CCGGCGTCAGTATCAGTCCCTATAACTCGAGTTATAGGGACTGATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198703
VALIDATED
WNK1 MISSION shRNA shRNA Plasmid DNA
WNK lysine deficient protein kinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-4187s1c1
Sequence:CCGGCGTCAGTATCAGTCCCTATAACTCGAGTTATAGGGACTGATACTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198703.1-1656s1c1
Sequence:CCGGGCTGCGTATTGAAGATATTAACTCGAGTTAATATCTTCAATACGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-6146s1c1
Sequence:CCGGCCCATTTGAATGGGCCATCTTCTCGAGAAGATGGCCCATTCAAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-2079s1c1
Sequence:CCGGGCAACCTAGTATATCTGTGTTCTCGAGAACACAGATATACTAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-6257s1c1
Sequence:CCGGCCGTCCAGAATCTAAGTCAAACTCGAGTTTGACTTAGATTCTGGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-6257s21c1
Sequence:CCGGCCGTCCAGAATCTAAGTCAAACTCGAGTTTGACTTAGATTCTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-2079s21c1
Sequence:CCGGGCAACCTAGTATATCTGTGTTCTCGAGAACACAGATATACTAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-1656s21c1
Sequence:CCGGGCTGCGTATTGAAGATATTAACTCGAGTTAATATCTTCAATACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-6146s21c1
Sequence:CCGGCCCATTTGAATGGGCCATCTTCTCGAGAAGATGGCCCATTCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-4187s21c1
Sequence:CCGGCGTCAGTATCAGTCCCTATAACTCGAGTTATAGGGACTGATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198703
VALIDATED
WNK1 MISSION shRNA Lentiviral Transduction Particles
WNK lysine deficient protein kinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-4187s1c1
Sequence:CCGGCGTCAGTATCAGTCCCTATAACTCGAGTTATAGGGACTGATACTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198703.1-1656s1c1
Sequence:CCGGGCTGCGTATTGAAGATATTAACTCGAGTTAATATCTTCAATACGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-6146s1c1
Sequence:CCGGCCCATTTGAATGGGCCATCTTCTCGAGAAGATGGCCCATTCAAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-2079s1c1
Sequence:CCGGGCAACCTAGTATATCTGTGTTCTCGAGAACACAGATATACTAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198703.1-6257s1c1
Sequence:CCGGCCGTCCAGAATCTAAGTCAAACTCGAGTTTGACTTAGATTCTGGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-6257s21c1
Sequence:CCGGCCGTCCAGAATCTAAGTCAAACTCGAGTTTGACTTAGATTCTGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-2079s21c1
Sequence:CCGGGCAACCTAGTATATCTGTGTTCTCGAGAACACAGATATACTAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-1656s21c1
Sequence:CCGGGCTGCGTATTGAAGATATTAACTCGAGTTAATATCTTCAATACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-6146s21c1
Sequence:CCGGCCCATTTGAATGGGCCATCTTCTCGAGAAGATGGCCCATTCAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198703.1-4187s21c1
Sequence:CCGGCGTCAGTATCAGTCCCTATAACTCGAGTTATAGGGACTGATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018979
VALIDATED
WNK1 MISSION shRNA Bacterial Glycerol Stock
WNK lysine deficient protein kinase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018979.x-3467s1c1
Sequence:CCGGCCGAGGAGATAGCAACAATTACTCGAGTAATTGTTGCTATCTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018979.x-4232s1c1
Sequence:CCGGGCGTAGTTTCAAGTATCACAACTCGAGTTGTGATACTTGAAACTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018979.x-2909s1c1
Sequence:CCGGGCATCCATTCTACAGTCCTATCTCGAGATAGGACTGTAGAATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018979.x-1041s1c1
Sequence:CCGGCCGCGATCTTAAATGTGACAACTCGAGTTGTCACATTTAAGATCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018979.1-6750s1c1
Sequence:CCGGGCACAAGTTGGTAGACAATTGCTCGAGCAATTGTCTACCAACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018979.1-2986s1c1
Sequence:CCGGCAGCCTTATGTGGAATCAAATCTCGAGATTTGATTCCACATAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018979.1-4663s1c1
Sequence:CCGGGCAGGAGTGTCTAGTTATATTCTCGAGAATATAACTAGACACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018979.2-7752s21c1
Sequence:CCGGGCTGCATTTAACTGGTTATTTCTCGAGAAATAACCAGTTAAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018979.2-1706s21c1
Sequence:CCGGATGAATCCGTTGACGTTTATGCTCGAGCATAAACGTCAACGGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018979.2-7658s21c1
Sequence:CCGGCCTAGAGACATTAACTGAATACTCGAGTATTCAGTTAATGTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219720    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018979.2-9361s1c1
Sequence:CCGGCCTTGTAATGGGTAGTTATTACTCGAGTAATAACTACCCATTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018979.2-9231s1c1
Sequence:CCGGGTTGCAGGATCATAATCTATTCTCGAGAATAGATTATGATCCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018979.2-4264s1c1
Sequence:CCGGTCTGCGGGAAGGCGGTTTATACTCGAGTATAAACCGCCTTCCCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018979.2-7895s21c1
Sequence:CCGGGACCATGCTTTCCTGTTTATCCTCGAGGATAAACAGGAAAGCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018979
VALIDATED
WNK1 MISSION shRNA shRNA Plasmid DNA
WNK lysine deficient protein kinase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018979.x-3467s1c1
Sequence:CCGGCCGAGGAGATAGCAACAATTACTCGAGTAATTGTTGCTATCTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018979.x-4232s1c1
Sequence:CCGGGCGTAGTTTCAAGTATCACAACTCGAGTTGTGATACTTGAAACTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018979.x-2909s1c1
Sequence:CCGGGCATCCATTCTACAGTCCTATCTCGAGATAGGACTGTAGAATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018979.x-1041s1c1
Sequence:CCGGCCGCGATCTTAAATGTGACAACTCGAGTTGTCACATTTAAGATCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018979.1-6750s1c1
Sequence:CCGGGCACAAGTTGGTAGACAATTGCTCGAGCAATTGTCTACCAACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018979.1-2986s1c1
Sequence:CCGGCAGCCTTATGTGGAATCAAATCTCGAGATTTGATTCCACATAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018979.1-4663s1c1
Sequence:CCGGGCAGGAGTGTCTAGTTATATTCTCGAGAATATAACTAGACACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018979.2-7752s21c1
Sequence:CCGGGCTGCATTTAACTGGTTATTTCTCGAGAAATAACCAGTTAAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018979.2-1706s21c1
Sequence:CCGGATGAATCCGTTGACGTTTATGCTCGAGCATAAACGTCAACGGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018979.2-7658s21c1
Sequence:CCGGCCTAGAGACATTAACTGAATACTCGAGTATTCAGTTAATGTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219720    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018979.2-9361s1c1
Sequence:CCGGCCTTGTAATGGGTAGTTATTACTCGAGTAATAACTACCCATTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018979.2-9231s1c1
Sequence:CCGGGTTGCAGGATCATAATCTATTCTCGAGAATAGATTATGATCCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018979.2-4264s1c1
Sequence:CCGGTCTGCGGGAAGGCGGTTTATACTCGAGTATAAACCGCCTTCCCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018979.2-7895s21c1
Sequence:CCGGGACCATGCTTTCCTGTTTATCCTCGAGGATAAACAGGAAAGCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018979
VALIDATED
WNK1 MISSION shRNA Lentiviral Transduction Particles
WNK lysine deficient protein kinase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018979.x-3467s1c1
Sequence:CCGGCCGAGGAGATAGCAACAATTACTCGAGTAATTGTTGCTATCTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018979.x-4232s1c1
Sequence:CCGGGCGTAGTTTCAAGTATCACAACTCGAGTTGTGATACTTGAAACTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018979.x-2909s1c1
Sequence:CCGGGCATCCATTCTACAGTCCTATCTCGAGATAGGACTGTAGAATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018979.x-1041s1c1
Sequence:CCGGCCGCGATCTTAAATGTGACAACTCGAGTTGTCACATTTAAGATCGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018979.1-6750s1c1
Sequence:CCGGGCACAAGTTGGTAGACAATTGCTCGAGCAATTGTCTACCAACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018979.1-2986s1c1
Sequence:CCGGCAGCCTTATGTGGAATCAAATCTCGAGATTTGATTCCACATAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018979.1-4663s1c1
Sequence:CCGGGCAGGAGTGTCTAGTTATATTCTCGAGAATATAACTAGACACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018979.2-7752s21c1
Sequence:CCGGGCTGCATTTAACTGGTTATTTCTCGAGAAATAACCAGTTAAATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018979.2-1706s21c1
Sequence:CCGGATGAATCCGTTGACGTTTATGCTCGAGCATAAACGTCAACGGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018979.2-7658s21c1
Sequence:CCGGCCTAGAGACATTAACTGAATACTCGAGTATTCAGTTAATGTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219720    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018979.2-9361s1c1
Sequence:CCGGCCTTGTAATGGGTAGTTATTACTCGAGTAATAACTACCCATTACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018979.2-9231s1c1
Sequence:CCGGGTTGCAGGATCATAATCTATTCTCGAGAATAGATTATGATCCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018979.2-4264s1c1
Sequence:CCGGTCTGCGGGAAGGCGGTTTATACTCGAGTATAAACCGCCTTCCCGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018979.2-7895s21c1
Sequence:CCGGGACCATGCTTTCCTGTTTATCCTCGAGGATAAACAGGAAAGCATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks