EMAIL THIS PAGE TO A FRIEND

WNK2

WNK lysine deficient protein kinase 2

Synonyms: NY-CO-43 P/OKcl.13 PRKWNK2 SDCCAG43
UniProtKB ID: Q9Y3S1, Q5VWF1, Q5VWF2, Q8IY36, Q9C0A3, Q9H3P4
Gene ID:
Human(65268) Summary: The protein encoded by this gene is a cytoplasmic serine-threonine kinase that contains cysteine in place of the lysine found at the conserved ATP-binding location in subdomain II of protein kinases. Since this protein does have kinase activity, it is possible that another lysine in the kinase subdomain I can substitute for the missing conserved lysine. [provided by RefSeq, Jul 2008]
Mouse(75607) WNK lysine deficient protein kinase 2
Rat(306811) WNK lysine deficient protein kinase 2
Thale Cress(821810) serine/threonine-protein kinase WNK2
domestic cat(101092650) WNK lysine deficient protein kinase 2
chicken(415984) WNK lysine deficient protein kinase 2
domestic guinea pig(100722532) WNK lysine deficient protein kinase 2
naked mole-rat(101722783) WNK lysine deficient protein kinase 2
cow(506520) WNK lysine deficient protein kinase 2
sheep(101111612) WNK lysine deficient protein kinase 2
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029361 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029361 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029361 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006648 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006648 Rosetta Predictions human pricing
XM_225204 Rosetta Predictions rat pricing
XR_007501 Rosetta Predictions rat pricing
NM_029361 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108621 predicted 6143
2 SASI_Hs01_00108622 predicted 3401
3 SASI_Hs01_00108624 predicted 4633
4 SASI_Hs01_00108625 predicted 3678
5 SASI_Hs01_00108626 predicted 3455
6 SASI_Hs01_00108627 predicted 3261
7 SASI_Hs01_00108628 predicted 765
8 SASI_Hs01_00108630 predicted 804
9 SASI_Hs02_00342017 predicted 1192
10 SASI_Hs02_00342018 predicted 1003
11 SASI_Hs01_00108623 predicted 730
12 SASI_Hs01_00108629 predicted 4078
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382607 predicted 4169
2 SASI_Rn02_00382608 predicted 1713
3 SASI_Rn02_00382609 predicted 2976
4 SASI_Rn02_00382610 predicted 4251
5 SASI_Rn02_00382611 predicted 1396
6 SASI_Rn02_00382612 predicted 6605
7 SASI_Rn02_00382613 predicted 5153
8 SASI_Rn02_00382614 predicted 1738
9 SASI_Rn02_00382615 predicted 1800
10 SASI_Rn02_00382616 predicted 2106
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176209 predicted 3992
2 SASI_Rn02_00414747 predicted 1527
3 SASI_Rn01_00176210 predicted 2802
4 SASI_Rn01_00176211 predicted 1213
5 SASI_Rn01_00176212 predicted 6424
6 SASI_Rn01_00176213 predicted 4974
7 SASI_Rn01_00176215 predicted 1558
8 SASI_Rn01_00176216 predicted 1627
9 SASI_Rn01_00176217 predicted 1920
10 SASI_Rn01_00176218 predicted 6392
11 SASI_Rn01_00176214 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194459 predicted 5042
2 SASI_Mm01_00194462 predicted 3498
3 SASI_Mm01_00194463 predicted 3725
4 SASI_Mm01_00194464 predicted 3988
5 SASI_Mm02_00335224 predicted 5298
6 SASI_Mm01_00194466 predicted 5739
7 SASI_Mm01_00194467 predicted 1720
8 SASI_Mm02_00335225 predicted 5164
9 SASI_Mm01_00194468 predicted 5718
10 SASI_Mm02_00335226 predicted 3717
11 SASI_Mm01_00194460 predicted 5299
12 SASI_Mm01_00194461 predicted 4765
13 SASI_Mm01_00194465 predicted 1465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029361
WNK2 MISSION shRNA Bacterial Glycerol Stock
WNK lysine deficient protein kinase 2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029361.3-1515s21c1
Sequence:CCGGGGTGCATGATCCGGAGATTAACTCGAGTTAATCTCCGGATCATGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029361.3-4162s21c1
Sequence:CCGGTTGACGGACAAACCTAGTTTCCTCGAGGAAACTAGGTTTGTCCGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029361.3-1730s21c1
Sequence:CCGGACAATGGAGCCATAGAGTTTACTCGAGTAAACTCTATGGCTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029361
WNK2 MISSION shRNA shRNA Plasmid DNA
WNK lysine deficient protein kinase 2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029361.3-1515s21c1
Sequence:CCGGGGTGCATGATCCGGAGATTAACTCGAGTTAATCTCCGGATCATGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029361.3-4162s21c1
Sequence:CCGGTTGACGGACAAACCTAGTTTCCTCGAGGAAACTAGGTTTGTCCGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029361.3-1730s21c1
Sequence:CCGGACAATGGAGCCATAGAGTTTACTCGAGTAAACTCTATGGCTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029361
WNK2 MISSION shRNA Lentiviral Transduction Particles
WNK lysine deficient protein kinase 2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029361.3-1515s21c1
Sequence:CCGGGGTGCATGATCCGGAGATTAACTCGAGTTAATCTCCGGATCATGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029361.3-4162s21c1
Sequence:CCGGTTGACGGACAAACCTAGTTTCCTCGAGGAAACTAGGTTTGTCCGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029361.3-1730s21c1
Sequence:CCGGACAATGGAGCCATAGAGTTTACTCGAGTAAACTCTATGGCTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006648
WNK2 MISSION shRNA Bacterial Glycerol Stock
WNK lysine deficient protein kinase 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006648.3-5224s1c1
Sequence:CCGGGCCAAGACTGTGGGCCGTTTCCTCGAGGAAACGGCCCACAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-609s1c1
Sequence:CCGGCGGTTCCTTCAAGACGGTCTACTCGAGTAGACCGTCTTGAAGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-3564s1c1
Sequence:CCGGGCTTACCATCTTGAACGTGTGCTCGAGCACACGTTCAAGATGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006648.3-6683s1c1
Sequence:CCGGGCCGTCTAAGTGGAGAAGTGACTCGAGTCACTTCTCCACTTAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-6152s1c1
Sequence:CCGGCCTATAAGTCTAGTAGCAAACCTCGAGGTTTGCTACTAGACTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-1270s1c1
Sequence:CCGGCCTGAAATCAAGGAGATTATTCTCGAGAATAATCTCCTTGATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006648.3-1532s1c1
Sequence:CCGGCCCAAGAGATGATTGAGTCTGCTCGAGCAGACTCAATCATCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-1315s1c1
Sequence:CCGGGAGGAAAGGTACGAGATCAAACTCGAGTTTGATCTCGTACCTTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-964s1c1
Sequence:CCGGCGAGACCTGAAATGTGACAATCTCGAGATTGTCACATTTCAGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-843s1c1
Sequence:CCGGGACGCTGAAGACATACCTGAACTCGAGTTCAGGTATGTCTTCAGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-4029s1c1
Sequence:CCGGCCAAGATTCAGCGCCCTATAACTCGAGTTATAGGGCGCTGAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-3674s1c1
Sequence:CCGGCCGATGAAATTGCCACGTATACTCGAGTATACGTGGCAATTTCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006648
WNK2 MISSION shRNA shRNA Plasmid DNA
WNK lysine deficient protein kinase 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006648.3-5224s1c1
Sequence:CCGGGCCAAGACTGTGGGCCGTTTCCTCGAGGAAACGGCCCACAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-609s1c1
Sequence:CCGGCGGTTCCTTCAAGACGGTCTACTCGAGTAGACCGTCTTGAAGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-3564s1c1
Sequence:CCGGGCTTACCATCTTGAACGTGTGCTCGAGCACACGTTCAAGATGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006648.3-6683s1c1
Sequence:CCGGGCCGTCTAAGTGGAGAAGTGACTCGAGTCACTTCTCCACTTAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-6152s1c1
Sequence:CCGGCCTATAAGTCTAGTAGCAAACCTCGAGGTTTGCTACTAGACTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-1270s1c1
Sequence:CCGGCCTGAAATCAAGGAGATTATTCTCGAGAATAATCTCCTTGATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006648.3-1532s1c1
Sequence:CCGGCCCAAGAGATGATTGAGTCTGCTCGAGCAGACTCAATCATCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-1315s1c1
Sequence:CCGGGAGGAAAGGTACGAGATCAAACTCGAGTTTGATCTCGTACCTTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-964s1c1
Sequence:CCGGCGAGACCTGAAATGTGACAATCTCGAGATTGTCACATTTCAGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-843s1c1
Sequence:CCGGGACGCTGAAGACATACCTGAACTCGAGTTCAGGTATGTCTTCAGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-4029s1c1
Sequence:CCGGCCAAGATTCAGCGCCCTATAACTCGAGTTATAGGGCGCTGAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-3674s1c1
Sequence:CCGGCCGATGAAATTGCCACGTATACTCGAGTATACGTGGCAATTTCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006648
WNK2 MISSION shRNA Lentiviral Transduction Particles
WNK lysine deficient protein kinase 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006648.3-5224s1c1
Sequence:CCGGGCCAAGACTGTGGGCCGTTTCCTCGAGGAAACGGCCCACAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-609s1c1
Sequence:CCGGCGGTTCCTTCAAGACGGTCTACTCGAGTAGACCGTCTTGAAGGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-3564s1c1
Sequence:CCGGGCTTACCATCTTGAACGTGTGCTCGAGCACACGTTCAAGATGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006648.3-6683s1c1
Sequence:CCGGGCCGTCTAAGTGGAGAAGTGACTCGAGTCACTTCTCCACTTAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-6152s1c1
Sequence:CCGGCCTATAAGTCTAGTAGCAAACCTCGAGGTTTGCTACTAGACTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.3-1270s1c1
Sequence:CCGGCCTGAAATCAAGGAGATTATTCTCGAGAATAATCTCCTTGATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006648.3-1532s1c1
Sequence:CCGGCCCAAGAGATGATTGAGTCTGCTCGAGCAGACTCAATCATCTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-1315s1c1
Sequence:CCGGGAGGAAAGGTACGAGATCAAACTCGAGTTTGATCTCGTACCTTTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-964s1c1
Sequence:CCGGCGAGACCTGAAATGTGACAATCTCGAGATTGTCACATTTCAGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-843s1c1
Sequence:CCGGGACGCTGAAGACATACCTGAACTCGAGTTCAGGTATGTCTTCAGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-4029s1c1
Sequence:CCGGCCAAGATTCAGCGCCCTATAACTCGAGTTATAGGGCGCTGAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006648.x-3674s1c1
Sequence:CCGGCCGATGAAATTGCCACGTATACTCGAGTATACGTGGCAATTTCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127323
WNK2 MISSION shRNA Bacterial Glycerol Stock
WNK lysine deficient protein kinase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-4255s1c1
Sequence:CCGGCACGGGAAAGAGGTGGTTTATCTCGAGATAAACCACCTCTTTCCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-1916s1c1
Sequence:CCGGCCTGAAATGTACGAGGAACATCTCGAGATGTTCCTCGTACATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-4498s1c1
Sequence:CCGGCCCTCCTGTGACTACTGTAATCTCGAGATTACAGTAGTCACAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-5265s1c1
Sequence:CCGGCAGAGTCATCTTCCAGCAATACTCGAGTATTGCTGGAAGATGACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-6038s1c1
Sequence:CCGGCTGAAGGAAATCTCGGAGCTACTCGAGTAGCTCCGAGATTTCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127323
WNK2 MISSION shRNA shRNA Plasmid DNA
WNK lysine deficient protein kinase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-4255s1c1
Sequence:CCGGCACGGGAAAGAGGTGGTTTATCTCGAGATAAACCACCTCTTTCCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-1916s1c1
Sequence:CCGGCCTGAAATGTACGAGGAACATCTCGAGATGTTCCTCGTACATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-4498s1c1
Sequence:CCGGCCCTCCTGTGACTACTGTAATCTCGAGATTACAGTAGTCACAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-5265s1c1
Sequence:CCGGCAGAGTCATCTTCCAGCAATACTCGAGTATTGCTGGAAGATGACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-6038s1c1
Sequence:CCGGCTGAAGGAAATCTCGGAGCTACTCGAGTAGCTCCGAGATTTCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127323
WNK2 MISSION shRNA Lentiviral Transduction Particles
WNK lysine deficient protein kinase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-4255s1c1
Sequence:CCGGCACGGGAAAGAGGTGGTTTATCTCGAGATAAACCACCTCTTTCCCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-1916s1c1
Sequence:CCGGCCTGAAATGTACGAGGAACATCTCGAGATGTTCCTCGTACATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-4498s1c1
Sequence:CCGGCCCTCCTGTGACTACTGTAATCTCGAGATTACAGTAGTCACAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-5265s1c1
Sequence:CCGGCAGAGTCATCTTCCAGCAATACTCGAGTATTGCTGGAAGATGACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127323.4-6038s1c1
Sequence:CCGGCTGAAGGAAATCTCGGAGCTACTCGAGTAGCTCCGAGATTTCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks