EMAIL THIS PAGE TO A FRIEND

WNK3

WNK lysine deficient protein kinase 3

Synonyms: PRKWNK3
UniProtKB ID: Q9BYP7, B1AKG2, Q5JRC1, Q6JP76, Q8TCX6, Q9HCK6
Gene ID:
Human(65267) Summary: This gene encodes a protein belonging to the 'with no lysine' family of serine-threonine protein kinases. These family members lack the catalytic lysine in subdomain II, and instead have a conserved lysine in subdomain I. This family member functions as a positive regulator of the transcellular Ca2+ transport pathway, and it plays a role in the increase of cell survival in a caspase-3-dependent pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(279561) WNK lysine deficient protein kinase 3
Rat(317420) WNK lysine deficient protein kinase 3
cow(100337119) WNK lysine deficient protein kinase 3
sheep(101117561) WNK lysine deficient protein kinase 3
naked mole-rat(101717892) WNK lysine deficient protein kinase 3
Domestic Rabbit(100344100) WNK lysine deficient protein kinase 3
domestic guinea pig(100720927) WNK lysine deficient protein kinase 3
Thale Cress(823984) putative serine/threonine-protein kinase WNK3
dog(491900) WNK lysine deficient protein kinase 3
domestic cat(101093000) WNK lysine deficient protein kinase 3
Horse(100060479) WNK lysine deficient protein kinase 3
227 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_205148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_205148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_205148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020922 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_909586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_909586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_909586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069381 MISSION® esiRNA esiRNA human WNK3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002838 Rosetta Predictions human pricing
NM_020922 Rosetta Predictions human pricing
XM_228874 Rosetta Predictions rat pricing
XR_008488 Rosetta Predictions rat pricing
XM_001481298 Rosetta Predictions mouse pricing
XM_909586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172511 predicted 1134
2 SASI_Hs01_00172512 predicted 5645
3 SASI_Hs01_00172513 predicted 2112
4 SASI_Hs01_00172514 predicted 3686
5 SASI_Hs01_00172516 predicted 1301
6 SASI_Hs02_00304222 predicted 1849
7 SASI_Hs01_00172517 predicted 1611
8 SASI_Hs01_00172518 predicted 1163
9 SASI_Hs02_00304223 predicted 4778
10 SASI_Hs02_00304224 predicted 3526
11 SASI_Hs01_00172515 predicted 1113
12 SASI_Hs01_00172519 predicted 5516
13 SASI_Hs01_00172520 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150298 predicted 1137
2 SASI_Hs01_00150299 predicted 5810
3 SASI_Hs01_00150300 predicted 2117
4 SASI_Hs01_00150301 predicted 3688
5 SASI_Hs01_00150303 predicted 1304
6 SASI_Hs02_00354293 predicted 1848
7 SASI_Hs01_00150304 predicted 1616
8 SASI_Hs01_00150305 predicted 1161
9 SASI_Hs02_00354294 predicted 4919
10 SASI_Hs02_00354295 predicted 3527
11 SASI_Hs01_00150302 predicted 1105
12 SASI_Hs01_00150306 predicted 5694
13 SASI_Hs01_00150307 predicted 1491
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194260 predicted 3344
2 SASI_Rn01_00194261 predicted 3291
3 SASI_Rn01_00194262 predicted 2343
4 SASI_Rn01_00194263 predicted 3937
5 SASI_Rn01_00194264 predicted 3330
6 SASI_Rn01_00194265 predicted 2787
7 SASI_Rn01_00194266 predicted 3521
8 SASI_Rn01_00194267 predicted 4311
9 SASI_Rn01_00194268 predicted 3119
10 SASI_Rn01_00194269 predicted 2623
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00417162 predicted 489
2 SASI_Rn02_00417163 predicted 287
3 SASI_Rn02_00417164 predicted 9943
4 SASI_Rn02_00417165 predicted 297
5 SASI_Rn02_00417166 predicted 527
6 SASI_Rn02_00417167 predicted 9963
7 SASI_Rn02_00417168 predicted 238
8 SASI_Rn02_00417169 predicted 10011
9 SASI_Rn02_00417170 predicted 9981
10 SASI_Rn02_00417171 predicted 477
11 SASI_Rn01_00161340 predicted 6068
12 SASI_Rn01_00161341 predicted 8716
13 SASI_Rn01_00161342 predicted 9977
14 SASI_Rn01_00161343 predicted 6117
15 SASI_Rn01_00161344 predicted 8618
16 SASI_Rn01_00161345 predicted 8503
17 SASI_Rn01_00161346 predicted 6282
18 SASI_Rn01_00161347 predicted 6043
19 SASI_Rn01_00161348 predicted 6445
20 SASI_Rn01_00161349 predicted 6176
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423504 predicted 3822
2 SASI_Mm02_00423505 predicted 1274
3 SASI_Mm02_00423506 predicted 900
4 SASI_Mm02_00423507 predicted 793
5 SASI_Mm02_00423508 predicted 1776
6 SASI_Mm02_00423509 predicted 5176
7 SASI_Mm02_00423510 predicted 879
8 SASI_Mm02_00423511 predicted 3146
9 SASI_Mm02_00423512 predicted 3573
10 SASI_Mm02_00423513 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229176 predicted 3797
2 SASI_Mm01_00229177 predicted 2407
3 SASI_Mm01_00229178 predicted 1275
4 SASI_Mm02_00434914 predicted 896
5 SASI_Mm01_00229179 predicted 800
6 SASI_Mm01_00229180 predicted 1773
7 SASI_Mm01_00229181 predicted 5156
8 SASI_Mm01_00229182 predicted 883
9 SASI_Mm02_00434915 predicted 3127
10 SASI_Mm01_00229183 predicted 3546
11 SASI_Mm01_00229175 predicted 1850
12 SASI_Mm01_00229184 predicted 4672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_205148
WNK3 MISSION shRNA Bacterial Glycerol Stock
WNK lysine deficient protein kinase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-1255s1c1
Sequence:CCGGGCTGACTATATGGTTGAAGATCTCGAGATCTTCAACCATATAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-2539s1c1
Sequence:CCGGCCCAGCGAGTTATGTTTACATCTCGAGATGTAAACATAACTCGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-1460s1c1
Sequence:CCGGCCACTCAAACTAGCAATGAATCTCGAGATTCATTGCTAGTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-3876s1c1
Sequence:CCGGGCCAAGTTTAAACCAACTCAACTCGAGTTGAGTTGGTTTAAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-373s1c1
Sequence:CCGGCCTGAGGAAGTAGCGTATGAACTCGAGTTCATACGCTACTTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_205148
WNK3 MISSION shRNA shRNA Plasmid DNA
WNK lysine deficient protein kinase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-1255s1c1
Sequence:CCGGGCTGACTATATGGTTGAAGATCTCGAGATCTTCAACCATATAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-2539s1c1
Sequence:CCGGCCCAGCGAGTTATGTTTACATCTCGAGATGTAAACATAACTCGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-1460s1c1
Sequence:CCGGCCACTCAAACTAGCAATGAATCTCGAGATTCATTGCTAGTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-3876s1c1
Sequence:CCGGGCCAAGTTTAAACCAACTCAACTCGAGTTGAGTTGGTTTAAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-373s1c1
Sequence:CCGGCCTGAGGAAGTAGCGTATGAACTCGAGTTCATACGCTACTTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_205148
WNK3 MISSION shRNA Lentiviral Transduction Particles
WNK lysine deficient protein kinase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-1255s1c1
Sequence:CCGGGCTGACTATATGGTTGAAGATCTCGAGATCTTCAACCATATAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-2539s1c1
Sequence:CCGGCCCAGCGAGTTATGTTTACATCTCGAGATGTAAACATAACTCGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-1460s1c1
Sequence:CCGGCCACTCAAACTAGCAATGAATCTCGAGATTCATTGCTAGTTTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-3876s1c1
Sequence:CCGGGCCAAGTTTAAACCAACTCAACTCGAGTTGAGTTGGTTTAAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205148.3-373s1c1
Sequence:CCGGCCTGAGGAAGTAGCGTATGAACTCGAGTTCATACGCTACTTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020922
VALIDATED
WNK3 MISSION shRNA Bacterial Glycerol Stock
WNK lysine deficient protein kinase 3
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-4699s1c1
Sequence:CCGGCGGTCAATTAAAGATAGCAAACTCGAGTTTGCTATCTTTAATTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-2746s1c1
Sequence:CCGGCGGGACACATTGCTCACTATACTCGAGTATAGTGAGCAATGTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-5208s1c1
Sequence:CCGGGCCTCACGTTTGTCAGTATAACTCGAGTTATACTGACAAACGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-2356s1c1
Sequence:CCGGGCAGACTATATGGTTGAAGATCTCGAGATCTTCAACCATATAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020922.x-1060s1c1
Sequence:CCGGGCAGCTCAAATATACCGGAAACTCGAGTTTCCGGTATATTTGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020922.2-7564s1c1
Sequence:CCGGGAGTTCTGTCTACTAGTAAACCTCGAGGTTTACTAGTAGACAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020922.2-2919s1c1
Sequence:CCGGCCACTGGAGTTGATTCTATTACTCGAGTAATAGAATCAACTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020922.2-6338s1c1
Sequence:CCGGCACATGTTTGTCTTAGGTTTACTCGAGTAAACCTAAGACAAACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.3-5820s21c1
Sequence:CCGGCAATCCCTCCTGGTCCTAAATCTCGAGATTTAGGACCAGGAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.3-4011s21c1
Sequence:CCGGCAAGTCAGCCTGCTAATATATCTCGAGATATATTAGCAGGCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.3-2343s21c1
Sequence:CCGGAGCTGACTCAGCCGCAGATTTCTCGAGAAATCTGCGGCTGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.2-1894s21c1
Sequence:CCGGAGACCGGGTGACGCCAATAAACTCGAGTTTATTGGCGTCACCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020922.2-7159s21c1
Sequence:CCGGACCCTAGAAGGATACTATTTACTCGAGTAAATAGTATCCTTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020922.2-1894s1c1
Sequence:CCGGAGACCGGGTGACGCCAATAAACTCGAGTTTATTGGCGTCACCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020922.2-1138s21c1
Sequence:GTACCGGGACCTTAAAGACGTACTTAAACTCGAGTTTAAGTACGTCTTTAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020922.2-1620s1c1
Sequence:CCGGTGTCTATCAGGGACCTATTAACTCGAGTTAATAGGTCCCTGATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020922.2-5129s21c1
Sequence:CCGGGAACGCCTTCGGTCAATTAAACTCGAGTTTAATTGACCGAAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.2-1620s21c1
Sequence:CCGGTGTCTATCAGGGACCTATTAACTCGAGTTAATAGGTCCCTGATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020922
VALIDATED
WNK3 MISSION shRNA shRNA Plasmid DNA
WNK lysine deficient protein kinase 3
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-4699s1c1
Sequence:CCGGCGGTCAATTAAAGATAGCAAACTCGAGTTTGCTATCTTTAATTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-2746s1c1
Sequence:CCGGCGGGACACATTGCTCACTATACTCGAGTATAGTGAGCAATGTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-5208s1c1
Sequence:CCGGGCCTCACGTTTGTCAGTATAACTCGAGTTATACTGACAAACGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-2356s1c1
Sequence:CCGGGCAGACTATATGGTTGAAGATCTCGAGATCTTCAACCATATAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020922.x-1060s1c1
Sequence:CCGGGCAGCTCAAATATACCGGAAACTCGAGTTTCCGGTATATTTGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020922.2-7564s1c1
Sequence:CCGGGAGTTCTGTCTACTAGTAAACCTCGAGGTTTACTAGTAGACAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020922.2-2919s1c1
Sequence:CCGGCCACTGGAGTTGATTCTATTACTCGAGTAATAGAATCAACTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020922.2-6338s1c1
Sequence:CCGGCACATGTTTGTCTTAGGTTTACTCGAGTAAACCTAAGACAAACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.3-5820s21c1
Sequence:CCGGCAATCCCTCCTGGTCCTAAATCTCGAGATTTAGGACCAGGAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.3-4011s21c1
Sequence:CCGGCAAGTCAGCCTGCTAATATATCTCGAGATATATTAGCAGGCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.3-2343s21c1
Sequence:CCGGAGCTGACTCAGCCGCAGATTTCTCGAGAAATCTGCGGCTGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.2-1894s21c1
Sequence:CCGGAGACCGGGTGACGCCAATAAACTCGAGTTTATTGGCGTCACCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020922.2-7159s21c1
Sequence:CCGGACCCTAGAAGGATACTATTTACTCGAGTAAATAGTATCCTTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020922.2-1894s1c1
Sequence:CCGGAGACCGGGTGACGCCAATAAACTCGAGTTTATTGGCGTCACCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020922.2-1138s21c1
Sequence:GTACCGGGACCTTAAAGACGTACTTAAACTCGAGTTTAAGTACGTCTTTAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020922.2-1620s1c1
Sequence:CCGGTGTCTATCAGGGACCTATTAACTCGAGTTAATAGGTCCCTGATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020922.2-5129s21c1
Sequence:CCGGGAACGCCTTCGGTCAATTAAACTCGAGTTTAATTGACCGAAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.2-1620s21c1
Sequence:CCGGTGTCTATCAGGGACCTATTAACTCGAGTTAATAGGTCCCTGATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020922
VALIDATED
WNK3 MISSION shRNA Lentiviral Transduction Particles
WNK lysine deficient protein kinase 3
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-4699s1c1
Sequence:CCGGCGGTCAATTAAAGATAGCAAACTCGAGTTTGCTATCTTTAATTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-2746s1c1
Sequence:CCGGCGGGACACATTGCTCACTATACTCGAGTATAGTGAGCAATGTGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-5208s1c1
Sequence:CCGGGCCTCACGTTTGTCAGTATAACTCGAGTTATACTGACAAACGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020922.x-2356s1c1
Sequence:CCGGGCAGACTATATGGTTGAAGATCTCGAGATCTTCAACCATATAGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020922.x-1060s1c1
Sequence:CCGGGCAGCTCAAATATACCGGAAACTCGAGTTTCCGGTATATTTGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020922.2-7564s1c1
Sequence:CCGGGAGTTCTGTCTACTAGTAAACCTCGAGGTTTACTAGTAGACAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020922.2-2919s1c1
Sequence:CCGGCCACTGGAGTTGATTCTATTACTCGAGTAATAGAATCAACTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195276    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020922.2-6338s1c1
Sequence:CCGGCACATGTTTGTCTTAGGTTTACTCGAGTAAACCTAAGACAAACATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.3-5820s21c1
Sequence:CCGGCAATCCCTCCTGGTCCTAAATCTCGAGATTTAGGACCAGGAGGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.3-4011s21c1
Sequence:CCGGCAAGTCAGCCTGCTAATATATCTCGAGATATATTAGCAGGCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.3-2343s21c1
Sequence:CCGGAGCTGACTCAGCCGCAGATTTCTCGAGAAATCTGCGGCTGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.2-1894s21c1
Sequence:CCGGAGACCGGGTGACGCCAATAAACTCGAGTTTATTGGCGTCACCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020922.2-7159s21c1
Sequence:CCGGACCCTAGAAGGATACTATTTACTCGAGTAAATAGTATCCTTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020922.2-1894s1c1
Sequence:CCGGAGACCGGGTGACGCCAATAAACTCGAGTTTATTGGCGTCACCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020922.2-1138s21c1
Sequence:GTACCGGGACCTTAAAGACGTACTTAAACTCGAGTTTAAGTACGTCTTTAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020922.2-1620s1c1
Sequence:CCGGTGTCTATCAGGGACCTATTAACTCGAGTTAATAGGTCCCTGATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020922.2-5129s21c1
Sequence:CCGGGAACGCCTTCGGTCAATTAAACTCGAGTTTAATTGACCGAAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020922.2-1620s21c1
Sequence:CCGGTGTCTATCAGGGACCTATTAACTCGAGTTAATAGGTCCCTGATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_909586
WNK3 MISSION shRNA Bacterial Glycerol Stock
WNK lysine deficient protein kinase 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000378290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_909586.2-4693s21c1
Sequence:CCGGGAACGCCTTCGAGCAACTAAACTCGAGTTTAGTTGCTCGAAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_909586.2-695s21c1
Sequence:CCGGGAACCTTAAAGACGTACTTAACTCGAGTTAAGTACGTCTTTAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_909586.2-526s21c1
Sequence:CCGGGAGCTACAGGACCGCAAATTACTCGAGTAATTTGCGGTCCTGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_909586
WNK3 MISSION shRNA shRNA Plasmid DNA
WNK lysine deficient protein kinase 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000378290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_909586.2-4693s21c1
Sequence:CCGGGAACGCCTTCGAGCAACTAAACTCGAGTTTAGTTGCTCGAAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_909586.2-695s21c1
Sequence:CCGGGAACCTTAAAGACGTACTTAACTCGAGTTAAGTACGTCTTTAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_909586.2-526s21c1
Sequence:CCGGGAGCTACAGGACCGCAAATTACTCGAGTAATTTGCGGTCCTGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_909586
WNK3 MISSION shRNA Lentiviral Transduction Particles
WNK lysine deficient protein kinase 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000378290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_909586.2-4693s21c1
Sequence:CCGGGAACGCCTTCGAGCAACTAAACTCGAGTTTAGTTGCTCGAAGGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_909586.2-695s21c1
Sequence:CCGGGAACCTTAAAGACGTACTTAACTCGAGTTAAGTACGTCTTTAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_909586.2-526s21c1
Sequence:CCGGGAGCTACAGGACCGCAAATTACTCGAGTAATTTGCGGTCCTGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks