EMAIL THIS PAGE TO A FRIEND

WNK4

WNK lysine deficient protein kinase 4

Synonyms: PHA2B PRKWNK4
UniProtKB ID: Q96J92, Q8N8X3, Q8N8Z2, Q96DT8, Q9BYS5
Gene ID:
Human(65266) Summary: This gene encodes a member of the WNK family of serine-threonine protein kinases. The kinase is part of the tight junction complex in kidney cells, and regulates the balance between NaCl reabsorption and K(+) secretion. The kinase regulates the activities of several types of ion channels, cotransporters, and exchangers involved in electrolyte flux in epithelial cells. Mutations in this gene result in pseudohypoaldosteronism type IIB.[provided by RefSeq, Sep 2009]
Mouse(69847) WNK lysine deficient protein kinase 4
Rat(287715) WNK lysine deficient protein kinase 4
Thale Cress(835947) putative serine/threonine-protein kinase WNK4
domestic cat(101100264) WNK lysine deficient protein kinase 4
dog(490959) WNK lysine deficient protein kinase 4
domestic guinea pig(100719313) WNK lysine deficient protein kinase 4
naked mole-rat(101722723) WNK lysine deficient protein kinase 4
cow(100849076) WNK lysine deficient protein kinase 4
sheep(101111820) WNK lysine deficient protein kinase 4
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079481 MISSION® esiRNA esiRNA human WNK4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032387 Rosetta Predictions human pricing
NM_175579 Rosetta Predictions rat pricing
NM_175638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089419 predicted 3814
2 SASI_Hs01_00089421 predicted 3469
3 SASI_Hs01_00089422 predicted 3839
4 SASI_Hs01_00089423 predicted 2100
5 SASI_Hs01_00089424 predicted 3735
6 SASI_Hs01_00089425 predicted 2161
7 SASI_Hs01_00089426 predicted 1154
8 SASI_Hs01_00089427 predicted 3448
9 SASI_Hs01_00089428 predicted 723
10 SASI_Hs02_00359785 predicted 2211
11 SASI_Hs01_00089420 predicted 3821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175579 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111641 predicted 509
2 SASI_Rn01_00111642 predicted 3663
3 SASI_Rn01_00111643 predicted 3753
4 SASI_Rn01_00111644 predicted 1137
5 SASI_Rn01_00111645 predicted 1101
6 SASI_Rn01_00111646 predicted 3024
7 SASI_Rn01_00111647 predicted 1574
8 SASI_Rn01_00111648 predicted 690
9 SASI_Rn01_00111649 predicted 1126
10 SASI_Rn02_00269479 predicted 1349
11 SASI_Rn01_00111640 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164606 predicted 573
2 SASI_Mm01_00164607 predicted 1215
3 SASI_Mm01_00164608 predicted 1290
4 SASI_Mm01_00164609 predicted 1154
5 SASI_Mm01_00164610 predicted 3709
6 SASI_Mm01_00164611 predicted 692
7 SASI_Mm01_00164612 predicted 751
8 SASI_Mm01_00164613 predicted 1243
9 SASI_Mm01_00164614 predicted 1390
10 SASI_Mm02_00346564 predicted 1626
11 SASI_Mm01_00164605 predicted 3448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032387
VALIDATED
WNK4 MISSION shRNA Bacterial Glycerol Stock
WNK lysine deficient protein kinase 4
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-923s21c1
Sequence:CCGGGGGATCTCAAGTGCGACAATGCTCGAGCATTGTCGCACTTGAGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-2222s21c1
Sequence:CCGGTCAGACGGATTCGGGAGATTACTCGAGTAATCTCCCGAATCCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032387.3-3893s1c1
Sequence:CCGGGGAGAGTGCAGCTCCATTATACTCGAGTATAATGGAGCTGCACTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032387.3-1229s1c1
Sequence:CCGGCCGAGGTGAAGGAGATCATTGCTCGAGCAATGATCTCCTTCACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-542s21c1
Sequence:CCGGTCAAGTTTGACATCGAGATTGCTCGAGCAATCTCGATGTCAAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-569s21c1
Sequence:CCGGGCTCCTTCAAGACGGTGTATCCTCGAGGATACACCGTCTTGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-2164s21c1
Sequence:CCGGATTGCAGCTGCCATGGTATATCTCGAGATATACCATGGCAGCTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-1510s21c1
Sequence:CCGGTTGGTCTGTGAAGCCGATTACCTCGAGGTAATCGGCTTCACAGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-2117s21c1
Sequence:CCGGAGATGGTGACCTTCCGATTTGCTCGAGCAAATCGGAAGGTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-1580s21c1
Sequence:CCGGAGCGTGAGAAGCTGCGTAAAGCTCGAGCTTTACGCAGCTTCTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032387.3-3649s1c1
Sequence:CCGGCCTGGCATCATGCGAAGGAACCTCGAGGTTCCTTCGCATGATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032387.3-3921s1c1
Sequence:CCGGGCCAAACATATGTGAACTGTTCTCGAGAACAGTTCACATATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032387.3-2174s1c1
Sequence:CCGGCCATGGTATATAACGAGTTCACTCGAGTGAACTCGTTATATACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032387.2-723s1c1
Sequence:CCGGCCGCTTCTATGATTCGTGGAACTCGAGTTCCACGAATCATAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032387.2-1590s1c1
Sequence:CCGGGCTGCGTAAAGCAAGGGAATTCTCGAGAATTCCCTTGCTTTACGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032387.2-2212s1c1
Sequence:CCGGGATGGATTTCTCAGACGGATTCTCGAGAATCCGTCTGAGAAATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032387.2-534s1c1
Sequence:CCGGCCGATACCTCAAGTTTGACATCTCGAGATGTCAAACTTGAGGTATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032387
VALIDATED
WNK4 MISSION shRNA shRNA Plasmid DNA
WNK lysine deficient protein kinase 4
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-923s21c1
Sequence:CCGGGGGATCTCAAGTGCGACAATGCTCGAGCATTGTCGCACTTGAGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-2222s21c1
Sequence:CCGGTCAGACGGATTCGGGAGATTACTCGAGTAATCTCCCGAATCCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032387.3-3893s1c1
Sequence:CCGGGGAGAGTGCAGCTCCATTATACTCGAGTATAATGGAGCTGCACTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032387.3-1229s1c1
Sequence:CCGGCCGAGGTGAAGGAGATCATTGCTCGAGCAATGATCTCCTTCACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-542s21c1
Sequence:CCGGTCAAGTTTGACATCGAGATTGCTCGAGCAATCTCGATGTCAAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-569s21c1
Sequence:CCGGGCTCCTTCAAGACGGTGTATCCTCGAGGATACACCGTCTTGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-2164s21c1
Sequence:CCGGATTGCAGCTGCCATGGTATATCTCGAGATATACCATGGCAGCTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-1510s21c1
Sequence:CCGGTTGGTCTGTGAAGCCGATTACCTCGAGGTAATCGGCTTCACAGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-2117s21c1
Sequence:CCGGAGATGGTGACCTTCCGATTTGCTCGAGCAAATCGGAAGGTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-1580s21c1
Sequence:CCGGAGCGTGAGAAGCTGCGTAAAGCTCGAGCTTTACGCAGCTTCTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032387.3-3649s1c1
Sequence:CCGGCCTGGCATCATGCGAAGGAACCTCGAGGTTCCTTCGCATGATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032387.3-3921s1c1
Sequence:CCGGGCCAAACATATGTGAACTGTTCTCGAGAACAGTTCACATATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032387.3-2174s1c1
Sequence:CCGGCCATGGTATATAACGAGTTCACTCGAGTGAACTCGTTATATACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032387.2-723s1c1
Sequence:CCGGCCGCTTCTATGATTCGTGGAACTCGAGTTCCACGAATCATAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032387.2-1590s1c1
Sequence:CCGGGCTGCGTAAAGCAAGGGAATTCTCGAGAATTCCCTTGCTTTACGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032387.2-2212s1c1
Sequence:CCGGGATGGATTTCTCAGACGGATTCTCGAGAATCCGTCTGAGAAATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032387.2-534s1c1
Sequence:CCGGCCGATACCTCAAGTTTGACATCTCGAGATGTCAAACTTGAGGTATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032387
VALIDATED
WNK4 MISSION shRNA Lentiviral Transduction Particles
WNK lysine deficient protein kinase 4
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-923s21c1
Sequence:CCGGGGGATCTCAAGTGCGACAATGCTCGAGCATTGTCGCACTTGAGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-2222s21c1
Sequence:CCGGTCAGACGGATTCGGGAGATTACTCGAGTAATCTCCCGAATCCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032387.3-3893s1c1
Sequence:CCGGGGAGAGTGCAGCTCCATTATACTCGAGTATAATGGAGCTGCACTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032387.3-1229s1c1
Sequence:CCGGCCGAGGTGAAGGAGATCATTGCTCGAGCAATGATCTCCTTCACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-542s21c1
Sequence:CCGGTCAAGTTTGACATCGAGATTGCTCGAGCAATCTCGATGTCAAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-569s21c1
Sequence:CCGGGCTCCTTCAAGACGGTGTATCCTCGAGGATACACCGTCTTGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-2164s21c1
Sequence:CCGGATTGCAGCTGCCATGGTATATCTCGAGATATACCATGGCAGCTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_032387.3-1510s21c1
Sequence:CCGGTTGGTCTGTGAAGCCGATTACCTCGAGGTAATCGGCTTCACAGACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-2117s21c1
Sequence:CCGGAGATGGTGACCTTCCGATTTGCTCGAGCAAATCGGAAGGTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032387.3-1580s21c1
Sequence:CCGGAGCGTGAGAAGCTGCGTAAAGCTCGAGCTTTACGCAGCTTCTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032387.3-3649s1c1
Sequence:CCGGCCTGGCATCATGCGAAGGAACCTCGAGGTTCCTTCGCATGATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032387.3-3921s1c1
Sequence:CCGGGCCAAACATATGTGAACTGTTCTCGAGAACAGTTCACATATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032387.3-2174s1c1
Sequence:CCGGCCATGGTATATAACGAGTTCACTCGAGTGAACTCGTTATATACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032387.2-723s1c1
Sequence:CCGGCCGCTTCTATGATTCGTGGAACTCGAGTTCCACGAATCATAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032387.2-1590s1c1
Sequence:CCGGGCTGCGTAAAGCAAGGGAATTCTCGAGAATTCCCTTGCTTTACGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032387.2-2212s1c1
Sequence:CCGGGATGGATTTCTCAGACGGATTCTCGAGAATCCGTCTGAGAAATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032387.2-534s1c1
Sequence:CCGGCCGATACCTCAAGTTTGACATCTCGAGATGTCAAACTTGAGGTATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175638
VALIDATED
WNK4 MISSION shRNA Bacterial Glycerol Stock
WNK lysine deficient protein kinase 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175638.2-2955s21c1
Sequence:CCGGAGAATGAGGCTTCCCGTAATCCTCGAGGATTACGGGAAGCCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175638.2-2997s21c1
Sequence:CCGGATGCTAGACTGGCACCTATATCTCGAGATATAGGTGCCAGTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175638.2-2675s21c1
Sequence:CCGGCTCCCATTCTCTCCTAGTTATCTCGAGATAACTAGGAGAGAATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175638.1-535s1c1
Sequence:CCGGCGATACCTCAAGTTTGACATTCTCGAGAATGTCAAACTTGAGGTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175638.1-2643s1c1
Sequence:CCGGCCTCCCATTCTCTCCTAGTTACTCGAGTAACTAGGAGAGAATGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175638.1-1742s1c1
Sequence:CCGGCCAGCTACTCATCAACTACATCTCGAGATGTAGTTGATGAGTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175638.1-1713s1c1
Sequence:CCGGCCAGCATCAATCCTTCCTCTTCTCGAGAAGAGGAAGGATTGATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175638.1-2965s1c1
Sequence:CCGGGATGCTAGACTGGCACCTATACTCGAGTATAGGTGCCAGTCTAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175638
VALIDATED
WNK4 MISSION shRNA shRNA Plasmid DNA
WNK lysine deficient protein kinase 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175638.2-2955s21c1
Sequence:CCGGAGAATGAGGCTTCCCGTAATCCTCGAGGATTACGGGAAGCCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175638.2-2997s21c1
Sequence:CCGGATGCTAGACTGGCACCTATATCTCGAGATATAGGTGCCAGTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175638.2-2675s21c1
Sequence:CCGGCTCCCATTCTCTCCTAGTTATCTCGAGATAACTAGGAGAGAATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175638.1-535s1c1
Sequence:CCGGCGATACCTCAAGTTTGACATTCTCGAGAATGTCAAACTTGAGGTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175638.1-2643s1c1
Sequence:CCGGCCTCCCATTCTCTCCTAGTTACTCGAGTAACTAGGAGAGAATGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175638.1-1742s1c1
Sequence:CCGGCCAGCTACTCATCAACTACATCTCGAGATGTAGTTGATGAGTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175638.1-1713s1c1
Sequence:CCGGCCAGCATCAATCCTTCCTCTTCTCGAGAAGAGGAAGGATTGATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175638.1-2965s1c1
Sequence:CCGGGATGCTAGACTGGCACCTATACTCGAGTATAGGTGCCAGTCTAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175638
VALIDATED
WNK4 MISSION shRNA Lentiviral Transduction Particles
WNK lysine deficient protein kinase 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175638.2-2955s21c1
Sequence:CCGGAGAATGAGGCTTCCCGTAATCCTCGAGGATTACGGGAAGCCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175638.2-2997s21c1
Sequence:CCGGATGCTAGACTGGCACCTATATCTCGAGATATAGGTGCCAGTCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175638.2-2675s21c1
Sequence:CCGGCTCCCATTCTCTCCTAGTTATCTCGAGATAACTAGGAGAGAATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175638.1-535s1c1
Sequence:CCGGCGATACCTCAAGTTTGACATTCTCGAGAATGTCAAACTTGAGGTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175638.1-2643s1c1
Sequence:CCGGCCTCCCATTCTCTCCTAGTTACTCGAGTAACTAGGAGAGAATGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175638.1-1742s1c1
Sequence:CCGGCCAGCTACTCATCAACTACATCTCGAGATGTAGTTGATGAGTAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175638.1-1713s1c1
Sequence:CCGGCCAGCATCAATCCTTCCTCTTCTCGAGAAGAGGAAGGATTGATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175638.1-2965s1c1
Sequence:CCGGGATGCTAGACTGGCACCTATACTCGAGTATAGGTGCCAGTCTAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks