EMAIL THIS PAGE TO A FRIEND

WNT10A

wingless-type MMTV integration site family, member 10A

Synonyms: OODD SSPS STHAG4
UniProtKB ID: Q9GZT5, Q53S44, Q96TA7, Q9H7S8
Gene ID:
Human(80326) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is strongly expressed in the cell lines of promyelocytic leukemia and Burkitt's lymphoma. In addition, it and another family member, the WNT6 gene, are strongly coexpressed in colorectal cancer cell lines. The gene overexpression may play key roles in carcinogenesis through activation of the WNT-beta-catenin-TCF signaling pathway. This gene and the WNT6 gene are clustered in the chromosome 2q35 region. [provided by RefSeq, Jul 2008]
Mouse(22409) wingless related MMTV integration site 10a
Rat(316527) wingless-type MMTV integration site family, member 10A
Zebrafish(30171) wingless-type MMTV integration site family, member 10a
domestic cat(101092455) wingless-type MMTV integration site family, member 10A
dog(488528) wingless-type MMTV integration site family, member 10A
chicken(429040) wingless-type MMTV integration site family, member 10A
domestic guinea pig(100713337) wingless-type MMTV integration site family, member 10A
naked mole-rat(101699309) wingless-type MMTV integration site family, member 10A
cow(537330) wingless-type MMTV integration site family, member 10A
sheep(101113129) wingless-type MMTV integration site family, member 10A
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025216 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029651 MISSION® esiRNA esiRNA targeting mouse Wnt10a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025216 Rosetta Predictions human pricing
NM_001108227 Rosetta Predictions rat pricing
NM_009518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358004 predicted 1010
2 SASI_Hs01_00082050 predicted 968
3 SASI_Hs01_00082051 predicted 822
4 SASI_Hs01_00082052 predicted 986
5 SASI_Hs01_00082053 predicted 625
6 SASI_Hs01_00082055 predicted 575
7 SASI_Hs01_00082056 predicted 986
8 SASI_Hs02_00358005 predicted 715
9 SASI_Hs01_00082057 predicted 1167
10 SASI_Hs01_00082058 predicted 693
11 SASI_Hs01_00082054 predicted 737
12 SASI_Hs01_00082059 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236574 predicted 2154
2 SASI_Rn02_00236575 predicted 1368
3 SASI_Rn02_00236576 predicted 2002
4 SASI_Rn02_00236577 predicted 1784
5 SASI_Rn02_00236578 predicted 1029
6 SASI_Rn02_00236579 predicted 1311
7 SASI_Rn02_00236580 predicted 1636
8 SASI_Rn02_00236581 predicted 2052
9 SASI_Rn02_00236582 predicted 818
10 SASI_Rn02_00236583 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061239 predicted 1916
2 SASI_Mm01_00061240 predicted 1229
3 SASI_Mm01_00061241 predicted 1044
4 SASI_Mm01_00061242 predicted 1377
5 SASI_Mm02_00316317 predicted 1855
6 SASI_Mm01_00061243 predicted 1364
7 SASI_Mm01_00061244 predicted 1321
8 SASI_Mm01_00061245 predicted 2016
9 SASI_Mm01_00061246 predicted 1854
10 SASI_Mm01_00061247 predicted 1376
11 SASI_Mm01_00061248 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009518
VALIDATED
WNT10A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 10A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009518.2-1360s21c1
Sequence:CCGGTCTGCGAAGAATGCCGCATCACTCGAGTGATGCGGCATTCTTCGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009518.2-1560s21c1
Sequence:CCGGAGTCCAGATCTGATTGACATTCTCGAGAATGTCAATCAGATCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009518.1-1379s1c1
Sequence:CCGGTGCTCGAATGAGACTCCACAACTCGAGTTGTGGAGTCTCATTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009518.1-1319s1c1
Sequence:CCGGCTTCGGAGAACGCTTCTCTAACTCGAGTTAGAGAAGCGTTCTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009518.1-1117s1c1
Sequence:CCGGGTAAACTGAAGGCTTGCGGTTCTCGAGAACCGCAAGCCTTCAGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009518.1-908s1c1
Sequence:CCGGCGCCTCTGCTATCCAGGGCATCTCGAGATGCCCTGGATAGCAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009518.1-1741s1c1
Sequence:CCGGGCCTGTGCAATAAGAGCAGCACTCGAGTGCTGCTCTTATTGCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009518
VALIDATED
WNT10A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 10A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009518.2-1360s21c1
Sequence:CCGGTCTGCGAAGAATGCCGCATCACTCGAGTGATGCGGCATTCTTCGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009518.2-1560s21c1
Sequence:CCGGAGTCCAGATCTGATTGACATTCTCGAGAATGTCAATCAGATCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009518.1-1379s1c1
Sequence:CCGGTGCTCGAATGAGACTCCACAACTCGAGTTGTGGAGTCTCATTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009518.1-1319s1c1
Sequence:CCGGCTTCGGAGAACGCTTCTCTAACTCGAGTTAGAGAAGCGTTCTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009518.1-1117s1c1
Sequence:CCGGGTAAACTGAAGGCTTGCGGTTCTCGAGAACCGCAAGCCTTCAGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009518.1-908s1c1
Sequence:CCGGCGCCTCTGCTATCCAGGGCATCTCGAGATGCCCTGGATAGCAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009518.1-1741s1c1
Sequence:CCGGGCCTGTGCAATAAGAGCAGCACTCGAGTGCTGCTCTTATTGCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009518
VALIDATED
WNT10A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 10A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009518.2-1360s21c1
Sequence:CCGGTCTGCGAAGAATGCCGCATCACTCGAGTGATGCGGCATTCTTCGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009518.2-1560s21c1
Sequence:CCGGAGTCCAGATCTGATTGACATTCTCGAGAATGTCAATCAGATCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009518.1-1379s1c1
Sequence:CCGGTGCTCGAATGAGACTCCACAACTCGAGTTGTGGAGTCTCATTCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009518.1-1319s1c1
Sequence:CCGGCTTCGGAGAACGCTTCTCTAACTCGAGTTAGAGAAGCGTTCTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009518.1-1117s1c1
Sequence:CCGGGTAAACTGAAGGCTTGCGGTTCTCGAGAACCGCAAGCCTTCAGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009518.1-908s1c1
Sequence:CCGGCGCCTCTGCTATCCAGGGCATCTCGAGATGCCCTGGATAGCAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009518.1-1741s1c1
Sequence:CCGGGCCTGTGCAATAAGAGCAGCACTCGAGTGCTGCTCTTATTGCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025216
WNT10A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 10A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025216.2-2177s21c1
Sequence:CCGGCATTCCCTTCATCATTCATTTCTCGAGAAATGAATGATGAAGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025216.2-1169s21c1
Sequence:CCGGAGAGACATCCACGCGAGAATGCTCGAGCATTCTCGCGTGGATGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025216.2-976s21c1
Sequence:CCGGTAGGAAGCTGCACCGCTTACACTCGAGTGTAAGCGGTGCAGCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025216.2-742s1c1
Sequence:CCGGCCACGAATGCCAACACCAATTCTCGAGAATTGGTGTTGGCATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025216.2-2025s1c1
Sequence:CCGGGTCAGTCTGTCTCCATCCTTTCTCGAGAAAGGATGGAGACAGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025216.2-1820s1c1
Sequence:CCGGGAGGAGATTGGACCACATGATCTCGAGATCATGTGGTCCAATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025216.2-1817s1c1
Sequence:CCGGGAAGAGGAGATTGGACCACATCTCGAGATGTGGTCCAATCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025216.2-813s1c1
Sequence:CCGGCCTATGAGAGTCCCATCTTCACTCGAGTGAAGATGGGACTCTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025216.2-577s1c1
Sequence:CCGGGTCAGCACCCAATGACATTCTCTCGAGAGAATGTCATTGGGTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025216
WNT10A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 10A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025216.2-2177s21c1
Sequence:CCGGCATTCCCTTCATCATTCATTTCTCGAGAAATGAATGATGAAGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025216.2-1169s21c1
Sequence:CCGGAGAGACATCCACGCGAGAATGCTCGAGCATTCTCGCGTGGATGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025216.2-976s21c1
Sequence:CCGGTAGGAAGCTGCACCGCTTACACTCGAGTGTAAGCGGTGCAGCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025216.2-742s1c1
Sequence:CCGGCCACGAATGCCAACACCAATTCTCGAGAATTGGTGTTGGCATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025216.2-2025s1c1
Sequence:CCGGGTCAGTCTGTCTCCATCCTTTCTCGAGAAAGGATGGAGACAGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025216.2-1820s1c1
Sequence:CCGGGAGGAGATTGGACCACATGATCTCGAGATCATGTGGTCCAATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025216.2-1817s1c1
Sequence:CCGGGAAGAGGAGATTGGACCACATCTCGAGATGTGGTCCAATCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025216.2-813s1c1
Sequence:CCGGCCTATGAGAGTCCCATCTTCACTCGAGTGAAGATGGGACTCTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025216.2-577s1c1
Sequence:CCGGGTCAGCACCCAATGACATTCTCTCGAGAGAATGTCATTGGGTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025216
WNT10A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 10A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025216.2-2177s21c1
Sequence:CCGGCATTCCCTTCATCATTCATTTCTCGAGAAATGAATGATGAAGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025216.2-1169s21c1
Sequence:CCGGAGAGACATCCACGCGAGAATGCTCGAGCATTCTCGCGTGGATGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025216.2-976s21c1
Sequence:CCGGTAGGAAGCTGCACCGCTTACACTCGAGTGTAAGCGGTGCAGCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025216.2-742s1c1
Sequence:CCGGCCACGAATGCCAACACCAATTCTCGAGAATTGGTGTTGGCATTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025216.2-2025s1c1
Sequence:CCGGGTCAGTCTGTCTCCATCCTTTCTCGAGAAAGGATGGAGACAGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025216.2-1820s1c1
Sequence:CCGGGAGGAGATTGGACCACATGATCTCGAGATCATGTGGTCCAATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025216.2-1817s1c1
Sequence:CCGGGAAGAGGAGATTGGACCACATCTCGAGATGTGGTCCAATCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025216.2-813s1c1
Sequence:CCGGCCTATGAGAGTCCCATCTTCACTCGAGTGAAGATGGGACTCTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025216.2-577s1c1
Sequence:CCGGGTCAGCACCCAATGACATTCTCTCGAGAGAATGTCATTGGGTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks