EMAIL THIS PAGE TO A FRIEND

WNT10B

wingless-type MMTV integration site family, member 10B

Synonyms: SHFM6 WNT-12
UniProtKB ID: O00744, B2R7A5, O00747, Q4VAJ5, Q8WZ97
Gene ID:
Human(7480) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It may be involved in breast cancer, and its protein signaling is likely a molecular switch that governs adipogenesis. This protein is 96% identical to the mouse Wnt10b protein at the amino acid level. This gene is clustered with another family member, WNT1, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]
Mouse(22410) wingless related MMTV integration site 10b
Rat(315294) wingless-type MMTV integration site family, member 10B
cow(539337) wingless-type MMTV integration site family, member 10B
sheep(101121252) wingless-type MMTV integration site family, member 10B
naked mole-rat(101722280) wingless-type MMTV integration site family, member 10B
Domestic Rabbit(100351316) wingless-type MMTV integration site family, member 10B
domestic guinea pig(100728910) wingless-type MMTV integration site family, member 10B
Zebrafish(30308) wingless-type MMTV integration site family, member 10b
Horse(100051649) wingless-type MMTV integration site family, member 10B
dog(486561) wingless-type MMTV integration site family, member 10B
domestic cat(101093948) wingless-type MMTV integration site family, member 10B
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003394 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072361 MISSION® esiRNA esiRNA human WNT10B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003394 Rosetta Predictions human pricing
NM_001108111 Rosetta Predictions rat pricing
NM_011718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111568 predicted 391
2 SASI_Hs01_00111569 predicted 1898
3 SASI_Hs01_00111570 predicted 388
4 SASI_Hs01_00111571 predicted 412
5 SASI_Hs02_00335582 predicted 1731
6 SASI_Hs01_00111573 predicted 1894
7 SASI_Hs01_00111574 predicted 424
8 SASI_Hs01_00111575 predicted 1258
9 SASI_Hs01_00111576 predicted 1456
10 SASI_Hs01_00111577 predicted 1773
11 SASI_Hs01_00111572 predicted 2004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235464 predicted 1343
2 SASI_Rn02_00235465 predicted 947
3 SASI_Rn02_00235466 predicted 1714
4 SASI_Rn02_00235467 predicted 1713
5 SASI_Rn02_00235468 predicted 946
6 SASI_Rn02_00235469 predicted 409
7 SASI_Rn02_00235470 predicted 801
8 SASI_Rn02_00235471 predicted 996
9 SASI_Rn02_00235472 predicted 1772
10 SASI_Rn02_00235473 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321286 predicted 1175
2 SASI_Mm01_00089376 predicted 419
3 SASI_Mm01_00089377 predicted 923
4 SASI_Mm01_00089378 predicted 1723
5 SASI_Mm01_00089379 predicted 945
6 SASI_Mm01_00089380 predicted 1250
7 SASI_Mm01_00089381 predicted 995
8 SASI_Mm01_00089382 predicted 1707
9 SASI_Mm01_00089383 predicted 408
10 SASI_Mm01_00089384 predicted 1441
11 SASI_Mm01_00089385 predicted 1487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011718
WNT10B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 10B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1478s1c1
Sequence:CCGGGAGTGGGTCAATGTGTGTAAACTCGAGTTTACACACATTGACCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1176s1c1
Sequence:CCGGCCATCTTTATCGATACCCACACTCGAGTGTGGGTATCGATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1441s1c1
Sequence:CCGGGTGCTGTTATGTGCTGTGTGACTCGAGTCACACAGCACATAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-414s1c1
Sequence:CCGGGCAATGAGATTCTGGGCCTTACTCGAGTAAGGCCCAGAATCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1095s1c1
Sequence:CCGGGCTGCCAATTCAAGACCTGTTCTCGAGAACAGGTCTTGAATTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011718
WNT10B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 10B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1478s1c1
Sequence:CCGGGAGTGGGTCAATGTGTGTAAACTCGAGTTTACACACATTGACCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1176s1c1
Sequence:CCGGCCATCTTTATCGATACCCACACTCGAGTGTGGGTATCGATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1441s1c1
Sequence:CCGGGTGCTGTTATGTGCTGTGTGACTCGAGTCACACAGCACATAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-414s1c1
Sequence:CCGGGCAATGAGATTCTGGGCCTTACTCGAGTAAGGCCCAGAATCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1095s1c1
Sequence:CCGGGCTGCCAATTCAAGACCTGTTCTCGAGAACAGGTCTTGAATTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011718
WNT10B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 10B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1478s1c1
Sequence:CCGGGAGTGGGTCAATGTGTGTAAACTCGAGTTTACACACATTGACCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1176s1c1
Sequence:CCGGCCATCTTTATCGATACCCACACTCGAGTGTGGGTATCGATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1441s1c1
Sequence:CCGGGTGCTGTTATGTGCTGTGTGACTCGAGTCACACAGCACATAACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-414s1c1
Sequence:CCGGGCAATGAGATTCTGGGCCTTACTCGAGTAAGGCCCAGAATCTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011718.1-1095s1c1
Sequence:CCGGGCTGCCAATTCAAGACCTGTTCTCGAGAACAGGTCTTGAATTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003394
WNT10B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 10B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-419s1c1
Sequence:CCGGCGGGCTCTAAGCAATGAGATTCTCGAGAATCTCATTGCTTAGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-964s1c1
Sequence:CCGGAGAGAAGTTCTCTCGGGATTTCTCGAGAAATCCCGAGAGAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-682s1c1
Sequence:CCGGCGGTTTCCGAGAAAGTGCTTTCTCGAGAAAGCACTTTCTCGGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-1457s1c1
Sequence:CCGGTGCTGCTATGTGCTGTGTGATCTCGAGATCACACAGCACATAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-1276s1c1
Sequence:CCGGCTTTGAGAAGTCTCCTGACTTCTCGAGAAGTCAGGAGACTTCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003394.2-1978s21c1
Sequence:CCGGGCTCCCTCTTGTGGGATAATGCTCGAGCATTATCCCACAAGAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003394.2-942s21c1
Sequence:CCGGGTAACCATGACATGGACTTTGCTCGAGCAAAGTCCATGTCATGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003394.2-1810s21c1
Sequence:CCGGCCCTTTAACCCTGATTCATACCTCGAGGTATGAATCAGGGTTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003394.2-1745s21c1
Sequence:CCGGTAGACACCTGAATGGACTAAGCTCGAGCTTAGTCCATTCAGGTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003394
WNT10B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 10B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-419s1c1
Sequence:CCGGCGGGCTCTAAGCAATGAGATTCTCGAGAATCTCATTGCTTAGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-964s1c1
Sequence:CCGGAGAGAAGTTCTCTCGGGATTTCTCGAGAAATCCCGAGAGAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-682s1c1
Sequence:CCGGCGGTTTCCGAGAAAGTGCTTTCTCGAGAAAGCACTTTCTCGGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-1457s1c1
Sequence:CCGGTGCTGCTATGTGCTGTGTGATCTCGAGATCACACAGCACATAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-1276s1c1
Sequence:CCGGCTTTGAGAAGTCTCCTGACTTCTCGAGAAGTCAGGAGACTTCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003394.2-1978s21c1
Sequence:CCGGGCTCCCTCTTGTGGGATAATGCTCGAGCATTATCCCACAAGAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003394.2-942s21c1
Sequence:CCGGGTAACCATGACATGGACTTTGCTCGAGCAAAGTCCATGTCATGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003394.2-1810s21c1
Sequence:CCGGCCCTTTAACCCTGATTCATACCTCGAGGTATGAATCAGGGTTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003394.2-1745s21c1
Sequence:CCGGTAGACACCTGAATGGACTAAGCTCGAGCTTAGTCCATTCAGGTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003394
WNT10B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 10B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-419s1c1
Sequence:CCGGCGGGCTCTAAGCAATGAGATTCTCGAGAATCTCATTGCTTAGAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-964s1c1
Sequence:CCGGAGAGAAGTTCTCTCGGGATTTCTCGAGAAATCCCGAGAGAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-682s1c1
Sequence:CCGGCGGTTTCCGAGAAAGTGCTTTCTCGAGAAAGCACTTTCTCGGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-1457s1c1
Sequence:CCGGTGCTGCTATGTGCTGTGTGATCTCGAGATCACACAGCACATAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003394.2-1276s1c1
Sequence:CCGGCTTTGAGAAGTCTCCTGACTTCTCGAGAAGTCAGGAGACTTCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003394.2-1978s21c1
Sequence:CCGGGCTCCCTCTTGTGGGATAATGCTCGAGCATTATCCCACAAGAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003394.2-942s21c1
Sequence:CCGGGTAACCATGACATGGACTTTGCTCGAGCAAAGTCCATGTCATGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003394.2-1810s21c1
Sequence:CCGGCCCTTTAACCCTGATTCATACCTCGAGGTATGAATCAGGGTTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003394.2-1745s21c1
Sequence:CCGGTAGACACCTGAATGGACTAAGCTCGAGCTTAGTCCATTCAGGTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks