EMAIL THIS PAGE TO A FRIEND

WNT11

wingless-type MMTV integration site family, member 11

Synonyms: HWNT11
UniProtKB ID: O96014, B2R8Z6, Q14DE8, Q8WZ98
Gene ID:
Human(7481) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 97%, 85%, and 63% amino acid identity with mouse, chicken, and Xenopus Wnt11 protein, respectively. This gene may play roles in the development of skeleton, kidney and lung, and is considered to be a plausible candidate gene for High Bone Mass Syndrome. [provided by RefSeq, Jul 2008]
Mouse(22411) wingless-related MMTV integration site 11
Rat(140584) wingless-type MMTV integration site family, member 11
Zebrafish(791595) wingless-type MMTV integration site family, member 11
dog(485183) wingless-type MMTV integration site family, member 11
domestic cat(101100080) wingless-type MMTV integration site family, member 11
chicken(395562) wingless-type MMTV integration site family, member 11
domestic guinea pig(100718108) wingless-type MMTV integration site family, member 11
naked mole-rat(101697582) wingless-type MMTV integration site family, member 11
cow(613288) wingless-type MMTV integration site family, member 11
sheep(101111048) wingless-type MMTV integration site family, member 11
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004626 Rosetta Predictions human pricing
XM_001065413 Rosetta Predictions rat pricing
XM_238122 Rosetta Predictions rat pricing
NM_009519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028076 predicted 680
2 SASI_Hs01_00028077 predicted 884
3 SASI_Hs02_00338023 predicted 933
4 SASI_Hs02_00338024 predicted 956
5 SASI_Hs01_00028078 predicted 631
6 SASI_Hs01_00028079 predicted 1385
7 SASI_Hs01_00028081 predicted 1166
8 SASI_Hs01_00028082 predicted 999
9 SASI_Hs01_00028083 predicted 870
10 SASI_Hs01_00028084 predicted 659
11 SASI_Hs01_00028080 predicted 1107
12 SASI_Hs01_00028085 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314054 predicted 1503
2 SASI_Rn02_00314055 predicted 1215
3 SASI_Rn02_00314056 predicted 1456
4 SASI_Rn02_00314057 predicted 1253
5 SASI_Rn02_00314058 predicted 1442
6 SASI_Rn02_00314059 predicted 1747
7 SASI_Rn02_00314060 predicted 1937
8 SASI_Rn02_00314061 predicted 1949
9 SASI_Rn02_00314062 predicted 1579
10 SASI_Rn02_00314063 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391226 predicted 1919
2 SASI_Rn02_00391227 predicted 1851
3 SASI_Rn02_00391228 predicted 1851
4 SASI_Rn02_00391229 predicted 778
5 SASI_Rn02_00391230 predicted 349
6 SASI_Rn02_00391231 predicted 1910
7 SASI_Rn02_00391232 predicted 1909
8 SASI_Rn02_00391233 predicted 287
9 SASI_Rn02_00391234 predicted 743
10 SASI_Rn02_00391235 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179251 predicted 1011
2 SASI_Mm01_00179252 predicted 785
3 SASI_Mm01_00179253 predicted 1442
4 SASI_Mm01_00179254 predicted 824
5 SASI_Mm01_00179255 predicted 332
6 SASI_Mm01_00179256 predicted 1019
7 SASI_Mm02_00316318 predicted 601
8 SASI_Mm01_00179257 predicted 1384
9 SASI_Mm01_00179258 predicted 1230
10 SASI_Mm01_00179259 predicted 867
11 SASI_Mm01_00179260 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004626
WNT11 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004626.2-1470s21c1
Sequence:CCGGTGGGATCGGTGAGACTGATACCTCGAGGTATCAGTCTCACCGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004626.2-929s21c1
Sequence:CCGGAGGACTCGGAACTCGTCTATCCTCGAGGATAGACGAGTTCCGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004626.2-1384s21c1
Sequence:CCGGGACATCAAAGGAAACCGACAACTCGAGTTGTCGGTTTCCTTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-676s1c1
Sequence:CCGGGCCAATAAACTGATGCGTCTACTCGAGTAGACGCATCAGTTTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-731s1c1
Sequence:CCGGCCTCTCTGGAAATGAAGTGTACTCGAGTACACTTCATTTCCAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-961s1c1
Sequence:CCGGCCTGACTTCTGCATGAAGAATCTCGAGATTCTTCATGCAGAAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004626.2-1316s1c1
Sequence:CCGGGCTTGTGCTTTGCCTTCACTTCTCGAGAAGTGAAGGCAAAGCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-1014s1c1
Sequence:CCGGGCAGTGCAACAAGACATCCAACTCGAGTTGGATGTCTTGTTGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004626
WNT11 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004626.2-1470s21c1
Sequence:CCGGTGGGATCGGTGAGACTGATACCTCGAGGTATCAGTCTCACCGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004626.2-929s21c1
Sequence:CCGGAGGACTCGGAACTCGTCTATCCTCGAGGATAGACGAGTTCCGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004626.2-1384s21c1
Sequence:CCGGGACATCAAAGGAAACCGACAACTCGAGTTGTCGGTTTCCTTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-676s1c1
Sequence:CCGGGCCAATAAACTGATGCGTCTACTCGAGTAGACGCATCAGTTTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-731s1c1
Sequence:CCGGCCTCTCTGGAAATGAAGTGTACTCGAGTACACTTCATTTCCAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-961s1c1
Sequence:CCGGCCTGACTTCTGCATGAAGAATCTCGAGATTCTTCATGCAGAAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004626.2-1316s1c1
Sequence:CCGGGCTTGTGCTTTGCCTTCACTTCTCGAGAAGTGAAGGCAAAGCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-1014s1c1
Sequence:CCGGGCAGTGCAACAAGACATCCAACTCGAGTTGGATGTCTTGTTGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004626
WNT11 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004626.2-1470s21c1
Sequence:CCGGTGGGATCGGTGAGACTGATACCTCGAGGTATCAGTCTCACCGATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004626.2-929s21c1
Sequence:CCGGAGGACTCGGAACTCGTCTATCCTCGAGGATAGACGAGTTCCGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004626.2-1384s21c1
Sequence:CCGGGACATCAAAGGAAACCGACAACTCGAGTTGTCGGTTTCCTTTGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-676s1c1
Sequence:CCGGGCCAATAAACTGATGCGTCTACTCGAGTAGACGCATCAGTTTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-731s1c1
Sequence:CCGGCCTCTCTGGAAATGAAGTGTACTCGAGTACACTTCATTTCCAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-961s1c1
Sequence:CCGGCCTGACTTCTGCATGAAGAATCTCGAGATTCTTCATGCAGAAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004626.2-1316s1c1
Sequence:CCGGGCTTGTGCTTTGCCTTCACTTCTCGAGAAGTGAAGGCAAAGCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004626.2-1014s1c1
Sequence:CCGGGCAGTGCAACAAGACATCCAACTCGAGTTGGATGTCTTGTTGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009519
WNT11 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009519.1-1653s1c1
Sequence:CCGGCCGGCTTTCTGGAATGTTCTTCTCGAGAAGAACATTCCAGAAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-1161s1c1
Sequence:CCGGGCAGTGCAACAAGACTTCCAACTCGAGTTGGAAGTCTTGTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-787s1c1
Sequence:CCGGGATGCTCCTATGAAGGTGAAACTCGAGTTTCACCTTCATAGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-881s1c1
Sequence:CCGGCCCTGGAAACGAAGTGTAAATCTCGAGATTTACACTTCGTTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-1069s1c1
Sequence:CCGGCCTGTGAAGGACTCAGAACTTCTCGAGAAGTTCTGAGTCCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009519
WNT11 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009519.1-1653s1c1
Sequence:CCGGCCGGCTTTCTGGAATGTTCTTCTCGAGAAGAACATTCCAGAAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-1161s1c1
Sequence:CCGGGCAGTGCAACAAGACTTCCAACTCGAGTTGGAAGTCTTGTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-787s1c1
Sequence:CCGGGATGCTCCTATGAAGGTGAAACTCGAGTTTCACCTTCATAGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-881s1c1
Sequence:CCGGCCCTGGAAACGAAGTGTAAATCTCGAGATTTACACTTCGTTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-1069s1c1
Sequence:CCGGCCTGTGAAGGACTCAGAACTTCTCGAGAAGTTCTGAGTCCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009519
WNT11 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009519.1-1653s1c1
Sequence:CCGGCCGGCTTTCTGGAATGTTCTTCTCGAGAAGAACATTCCAGAAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-1161s1c1
Sequence:CCGGGCAGTGCAACAAGACTTCCAACTCGAGTTGGAAGTCTTGTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-787s1c1
Sequence:CCGGGATGCTCCTATGAAGGTGAAACTCGAGTTTCACCTTCATAGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-881s1c1
Sequence:CCGGCCCTGGAAACGAAGTGTAAATCTCGAGATTTACACTTCGTTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009519.1-1069s1c1
Sequence:CCGGCCTGTGAAGGACTCAGAACTTCTCGAGAAGTTCTGAGTCCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks