EMAIL THIS PAGE TO A FRIEND

WNT16

wingless-type MMTV integration site family, member 16

UniProtKB ID: Q9UBV4, Q2M3G1, Q9Y5C0
Gene ID:
Human(51384) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008]
Mouse(93735) wingless-related MMTV integration site 16
Rat(500047) wingless-type MMTV integration site family, member 16
Zebrafish(791563) wingless-type MMTV integration site family, member 16
chicken(427856) wingless-type MMTV integration site family, member 16
dog(612328) wingless-type MMTV integration site family, member 16
domestic cat(101090252) wingless-type MMTV integration site family, member 16
cow(538627) wingless-type MMTV integration site family, member 16
sheep(101103229) wingless-type MMTV integration site family, member 16
naked mole-rat(101710484) wingless-type MMTV integration site family, member 16
Domestic Rabbit(100353090) wingless-type MMTV integration site family, member 16
domestic guinea pig(100721822) wingless-type MMTV integration site family, member 16
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41268 Anti-WNT16 antibody produced in rabbit IgG fraction of antiserum human, mouse, rat, guinea pig, bovine, horse, rabbit
western blot pricing
SAB2102712 Anti-WNT16 antibody produced in rabbit affinity isolated antibody mouse, rabbit, horse, bovine, human, rat, guinea pig
western blot pricing
HPA027030 Anti-WNT16 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016087 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085511 MISSION® esiRNA esiRNA human WNT16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016087 Rosetta Predictions human pricing
NM_057168 Rosetta Predictions human pricing
NM_001109223 Rosetta Predictions rat pricing
NM_053116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348841 predicted 890
2 SASI_Hs01_00224474 predicted 363
3 SASI_Hs01_00224475 predicted 1131
4 SASI_Hs01_00224476 predicted 657
5 SASI_Hs01_00224477 predicted 1032
6 SASI_Hs02_00348842 predicted 1128
7 SASI_Hs01_00224478 predicted 930
8 SASI_Hs01_00224480 predicted 448
9 SASI_Hs01_00224481 predicted 1075
10 SASI_Hs02_00348843 predicted 370
11 SASI_Hs01_00224473 predicted 1100
12 SASI_Hs01_00224479 predicted 782
13 SASI_Hs01_00224482 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362029 predicted 1128
2 SASI_Hs01_00232518 predicted 598
3 SASI_Hs01_00232519 predicted 1372
4 SASI_Hs01_00232520 predicted 895
5 SASI_Hs01_00232521 predicted 1273
6 SASI_Hs02_00362030 predicted 1366
7 SASI_Hs01_00232522 predicted 1168
8 SASI_Hs01_00232524 predicted 692
9 SASI_Hs01_00232525 predicted 1316
10 SASI_Hs02_00362031 predicted 611
11 SASI_Hs01_00232517 predicted 1329
12 SASI_Hs01_00232523 predicted 1027
13 SASI_Hs01_00232526 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246294 predicted 863
2 SASI_Rn02_00246295 predicted 1293
3 SASI_Rn02_00246296 predicted 623
4 SASI_Rn02_00246297 predicted 533
5 SASI_Rn02_00246298 predicted 812
6 SASI_Rn02_00246299 predicted 709
7 SASI_Rn02_00246300 predicted 1386
8 SASI_Rn02_00246301 predicted 1409
9 SASI_Rn02_00246302 predicted 454
10 SASI_Rn02_00246303 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337624 predicted 1145
2 SASI_Mm01_00035383 predicted 1291
3 SASI_Mm01_00035384 predicted 620
4 SASI_Mm01_00035385 predicted 526
5 SASI_Mm01_00035386 predicted 1408
6 SASI_Mm01_00035387 predicted 700
7 SASI_Mm01_00035388 predicted 445
8 SASI_Mm01_00035389 predicted 694
9 SASI_Mm01_00035390 predicted 631
10 SASI_Mm01_00035391 predicted 427
11 SASI_Mm01_00035392 predicted 1125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053116
WNT16 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053116.2-1401s1c1
Sequence:CCGGCCTCTGTAGTAACCAAGGTGTCTCGAGACACCTTGGTTACTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-869s1c1
Sequence:CCGGGCTAGCCATGAATCTACACAACTCGAGTTGTGTAGATTCATGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-452s1c1
Sequence:CCGGGCTGTGCAAGAGGAAACCGTACTCGAGTACGGTTTCCTCTTGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-1133s1c1
Sequence:CCGGCGTTCATAAGTCTCCCAACTACTCGAGTAGTTGGGAGACTTATGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-632s1c1
Sequence:CCGGGACAGCATTCATTTATGCCATCTCGAGATGGCATAAATGAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053116
WNT16 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053116.2-1401s1c1
Sequence:CCGGCCTCTGTAGTAACCAAGGTGTCTCGAGACACCTTGGTTACTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-869s1c1
Sequence:CCGGGCTAGCCATGAATCTACACAACTCGAGTTGTGTAGATTCATGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-452s1c1
Sequence:CCGGGCTGTGCAAGAGGAAACCGTACTCGAGTACGGTTTCCTCTTGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-1133s1c1
Sequence:CCGGCGTTCATAAGTCTCCCAACTACTCGAGTAGTTGGGAGACTTATGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-632s1c1
Sequence:CCGGGACAGCATTCATTTATGCCATCTCGAGATGGCATAAATGAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053116
WNT16 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053116.2-1401s1c1
Sequence:CCGGCCTCTGTAGTAACCAAGGTGTCTCGAGACACCTTGGTTACTACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-869s1c1
Sequence:CCGGGCTAGCCATGAATCTACACAACTCGAGTTGTGTAGATTCATGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-452s1c1
Sequence:CCGGGCTGTGCAAGAGGAAACCGTACTCGAGTACGGTTTCCTCTTGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-1133s1c1
Sequence:CCGGCGTTCATAAGTCTCCCAACTACTCGAGTAGTTGGGAGACTTATGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053116.2-632s1c1
Sequence:CCGGGACAGCATTCATTTATGCCATCTCGAGATGGCATAAATGAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016087
WNT16 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-658s1c1
Sequence:CCGGCGCCAAGTTGATGTCAGTAGACTCGAGTCTACTGACATCAACTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016087.2-2123s1c1
Sequence:CCGGCCTAAGAGCTAAGGCAGTAAACTCGAGTTTACTGCCTTAGCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-369s1c1
Sequence:CCGGCCAAAGAGACAGCATTTATTTCTCGAGAAATAAATGCTGTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-756s1c1
Sequence:CCGGGCCATTTGTTGAAGGATAAATCTCGAGATTTATCCTTCAACAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158684    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016087.2-1404s1c1
Sequence:CCGGGCAAGAAATAACAGGAAAGATCTCGAGATCTTTCCTGTTATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016087.2-1197s1c1
Sequence:CCGGGCGCTAGTAAAGTTGACTCTTCTCGAGAAGAGTCAACTTTACTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-939s1c1
Sequence:CCGGGCAGAGAATGCAACCGTACATCTCGAGATGTACGGTTGCATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016087.2-864s21c1
Sequence:CCGGATGATCTGCTCTATGTTAATACTCGAGTATTAACATAGAGCAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016087.2-1478s21c1
Sequence:CCGGTTAGTTACAGGACTCAATAATCTCGAGATTATTGAGTCCTGTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016087.2-1500s21c1
Sequence:CCGGGTGGGTGAACATTAGTCATTTCTCGAGAAATGACTAATGTTCACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016087
WNT16 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-658s1c1
Sequence:CCGGCGCCAAGTTGATGTCAGTAGACTCGAGTCTACTGACATCAACTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016087.2-2123s1c1
Sequence:CCGGCCTAAGAGCTAAGGCAGTAAACTCGAGTTTACTGCCTTAGCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-369s1c1
Sequence:CCGGCCAAAGAGACAGCATTTATTTCTCGAGAAATAAATGCTGTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-756s1c1
Sequence:CCGGGCCATTTGTTGAAGGATAAATCTCGAGATTTATCCTTCAACAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158684    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016087.2-1404s1c1
Sequence:CCGGGCAAGAAATAACAGGAAAGATCTCGAGATCTTTCCTGTTATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016087.2-1197s1c1
Sequence:CCGGGCGCTAGTAAAGTTGACTCTTCTCGAGAAGAGTCAACTTTACTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-939s1c1
Sequence:CCGGGCAGAGAATGCAACCGTACATCTCGAGATGTACGGTTGCATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016087.2-864s21c1
Sequence:CCGGATGATCTGCTCTATGTTAATACTCGAGTATTAACATAGAGCAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016087.2-1478s21c1
Sequence:CCGGTTAGTTACAGGACTCAATAATCTCGAGATTATTGAGTCCTGTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016087.2-1500s21c1
Sequence:CCGGGTGGGTGAACATTAGTCATTTCTCGAGAAATGACTAATGTTCACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016087
WNT16 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-658s1c1
Sequence:CCGGCGCCAAGTTGATGTCAGTAGACTCGAGTCTACTGACATCAACTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016087.2-2123s1c1
Sequence:CCGGCCTAAGAGCTAAGGCAGTAAACTCGAGTTTACTGCCTTAGCTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-369s1c1
Sequence:CCGGCCAAAGAGACAGCATTTATTTCTCGAGAAATAAATGCTGTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-756s1c1
Sequence:CCGGGCCATTTGTTGAAGGATAAATCTCGAGATTTATCCTTCAACAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158684    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016087.2-1404s1c1
Sequence:CCGGGCAAGAAATAACAGGAAAGATCTCGAGATCTTTCCTGTTATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016087.2-1197s1c1
Sequence:CCGGGCGCTAGTAAAGTTGACTCTTCTCGAGAAGAGTCAACTTTACTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166056    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016087.2-939s1c1
Sequence:CCGGGCAGAGAATGCAACCGTACATCTCGAGATGTACGGTTGCATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016087.2-864s21c1
Sequence:CCGGATGATCTGCTCTATGTTAATACTCGAGTATTAACATAGAGCAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016087.2-1478s21c1
Sequence:CCGGTTAGTTACAGGACTCAATAATCTCGAGATTATTGAGTCCTGTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016087.2-1500s21c1
Sequence:CCGGGTGGGTGAACATTAGTCATTTCTCGAGAAATGACTAATGTTCACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks