EMAIL THIS PAGE TO A FRIEND

WNT1

wingless-type MMTV integration site family, member 1

Synonyms: BMND16 INT1 OI15
UniProtKB ID: P04628, Q5U0N2
Gene ID:
Human(7471) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is very conserved in evolution, and the protein encoded by this gene is known to be 98% identical to the mouse Wnt1 protein at the amino acid level. The studies in mouse indicate that the Wnt1 protein functions in the induction of the mesencephalon and cerebellum. This gene was originally considered as a candidate gene for Joubert syndrome, an autosomal recessive disorder with cerebellar hypoplasia as a leading feature. However, further studies suggested that the gene mutations might not have a significant role in Joubert syndrome. This gene is clustered with another family member, WNT10B, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]
Mouse(22408) wingless-related MMTV integration site 1
Rat(24881) wingless-type MMTV integration site family, member 1
cow(540662) wingless-type MMTV integration site family, member 1
sheep(101103389) wingless-type MMTV integration site family, member 1
naked mole-rat(101722636) wingless-type MMTV integration site family, member 1
domestic guinea pig(100717026) wingless-type MMTV integration site family, member 1
Zebrafish(30128) wingless-type MMTV integration site family, member 1
dog(486560) wingless-type MMTV integration site family, member 1
Horse(100058859) wingless-type MMTV integration site family, member 1
domestic cat(101094190) wingless-type MMTV integration site family, member 1
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
W1894 Anti-WNT1 (276-290) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2102711 Anti-WNT1 antibody produced in rabbit affinity isolated antibody rabbit, human, guinea pig, canine, zebrafish, rat, bovine, horse, mouse
western blot pricing
SAB4503089 Anti-WNT1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB5300004 Monoclonal Anti-WNT1 antibody produced in mouse clone 10C8, ascites fluid human, mouse
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005430 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024721 MISSION® esiRNA esiRNA targeting mouse Wnt1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005430 Rosetta Predictions human pricing
NM_001105714 Rosetta Predictions rat pricing
NM_021279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223473 predicted 1078
2 SASI_Hs01_00223474 predicted 204
3 SASI_Hs01_00223475 predicted 327
4 SASI_Hs01_00223476 predicted 338
5 SASI_Hs01_00223477 predicted 392
6 SASI_Hs01_00223478 predicted 1053
7 SASI_Hs01_00223479 predicted 1400
8 SASI_Hs01_00223480 predicted 347
9 SASI_Hs01_00223482 predicted 1369
10 SASI_Hs02_00339580 predicted 1633
11 SASI_Hs01_00223481 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211806 predicted 695
2 SASI_Rn02_00211807 predicted 468
3 SASI_Rn02_00211808 predicted 468
4 SASI_Rn02_00211809 predicted 483
5 SASI_Rn02_00211810 predicted 908
6 SASI_Rn02_00211811 predicted 1761
7 SASI_Rn02_00211812 predicted 605
8 SASI_Rn02_00211813 predicted 1802
9 SASI_Rn02_00211814 predicted 1420
10 SASI_Rn02_00211815 predicted 1758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030630 predicted 694
2 SASI_Mm01_00030631 predicted 902
3 SASI_Mm01_00030632 predicted 1742
4 SASI_Mm01_00030633 predicted 1830
5 SASI_Mm01_00030636 predicted 943
6 SASI_Mm02_00325799 predicted 1813
7 SASI_Mm01_00030634 predicted 1833
8 SASI_Mm01_00030637 predicted 1907
9 SASI_Mm01_00030638 predicted 1662
10 SASI_Mm02_00325800 predicted 1191
11 SASI_Mm01_00030635 predicted 460
12 SASI_Mm01_00030639 predicted 1417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005430
WNT1 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.x-643s1c1
Sequence:CCGGAATCCTGCACGTGTGACTACCTCGAGGTAGTCACACGTGCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.x-348s1c1
Sequence:CCGGCAAGAGTCTGCAACTGGTACTCTCGAGAGTACCAGTTGCAGACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005430.x-2310s1c1
Sequence:CCGGAATCCAGAACACAACCTTGTCTCGAGACAAGGTTGTGTTCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005430.2-2021s1c1
Sequence:CCGGGCCACGAGTTTGGATGTTGTACTCGAGTACAACATCCAAACTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-336s1c1
Sequence:CCGGGCTTACAGACTCCAAGAGTCTCTCGAGAGACTCTTGGAGTCTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-626s1c1
Sequence:CCGGGCTCAGAAGGTTCCATCGAATCTCGAGATTCGATGGAACCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-558s1c1
Sequence:CCGGCTGTCGAGAAACGGCGTTTATCTCGAGATAAACGCCGTTTCTCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-1060s1c1
Sequence:CCGGGACCTCGTCTACTTCGAGAAACTCGAGTTTCTCGAAGTAGACGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005430
WNT1 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.x-643s1c1
Sequence:CCGGAATCCTGCACGTGTGACTACCTCGAGGTAGTCACACGTGCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.x-348s1c1
Sequence:CCGGCAAGAGTCTGCAACTGGTACTCTCGAGAGTACCAGTTGCAGACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005430.x-2310s1c1
Sequence:CCGGAATCCAGAACACAACCTTGTCTCGAGACAAGGTTGTGTTCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005430.2-2021s1c1
Sequence:CCGGGCCACGAGTTTGGATGTTGTACTCGAGTACAACATCCAAACTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-336s1c1
Sequence:CCGGGCTTACAGACTCCAAGAGTCTCTCGAGAGACTCTTGGAGTCTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-626s1c1
Sequence:CCGGGCTCAGAAGGTTCCATCGAATCTCGAGATTCGATGGAACCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-558s1c1
Sequence:CCGGCTGTCGAGAAACGGCGTTTATCTCGAGATAAACGCCGTTTCTCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-1060s1c1
Sequence:CCGGGACCTCGTCTACTTCGAGAAACTCGAGTTTCTCGAAGTAGACGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005430
WNT1 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.x-643s1c1
Sequence:CCGGAATCCTGCACGTGTGACTACCTCGAGGTAGTCACACGTGCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.x-348s1c1
Sequence:CCGGCAAGAGTCTGCAACTGGTACTCTCGAGAGTACCAGTTGCAGACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005430.x-2310s1c1
Sequence:CCGGAATCCAGAACACAACCTTGTCTCGAGACAAGGTTGTGTTCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005430.2-2021s1c1
Sequence:CCGGGCCACGAGTTTGGATGTTGTACTCGAGTACAACATCCAAACTCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-336s1c1
Sequence:CCGGGCTTACAGACTCCAAGAGTCTCTCGAGAGACTCTTGGAGTCTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-626s1c1
Sequence:CCGGGCTCAGAAGGTTCCATCGAATCTCGAGATTCGATGGAACCTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-558s1c1
Sequence:CCGGCTGTCGAGAAACGGCGTTTATCTCGAGATAAACGCCGTTTCTCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005430.2-1060s1c1
Sequence:CCGGGACCTCGTCTACTTCGAGAAACTCGAGTTTCTCGAAGTAGACGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021279
WNT1 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021279.3-2105s1c1
Sequence:CCGGGCGTTCGGTTATGTAAATAAACTCGAGTTTATTTACATAACCGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021279.3-348s1c1
Sequence:CCGGCTGGGTTTCTACTACGTTGCTCTCGAGAGCAACGTAGTAGAAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021279.3-1411s1c1
Sequence:CCGGCGCGTTCTGCACGAGTGTCTACTCGAGTAGACACTCGTGCAGAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021279.3-959s1c1
Sequence:CCGGAGATGCGCCAAGAGTGCAAATCTCGAGATTTGCACTCTTGGCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021279.4-602s21c1
Sequence:CCGGGCGAGAGTGCAAATGGCAATTCTCGAGAATTGCCATTTGCACTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021279.4-1792s21c1
Sequence:CCGGTGTGACCTCTTTGGGTATTATCTCGAGATAATACCCAAAGAGGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021279.4-1766s21c1
Sequence:CCGGGTTGCGGTTCCTGATGTATTTCTCGAGAAATACATCAGGAACCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021279
WNT1 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021279.3-2105s1c1
Sequence:CCGGGCGTTCGGTTATGTAAATAAACTCGAGTTTATTTACATAACCGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021279.3-348s1c1
Sequence:CCGGCTGGGTTTCTACTACGTTGCTCTCGAGAGCAACGTAGTAGAAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021279.3-1411s1c1
Sequence:CCGGCGCGTTCTGCACGAGTGTCTACTCGAGTAGACACTCGTGCAGAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021279.3-959s1c1
Sequence:CCGGAGATGCGCCAAGAGTGCAAATCTCGAGATTTGCACTCTTGGCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021279.4-602s21c1
Sequence:CCGGGCGAGAGTGCAAATGGCAATTCTCGAGAATTGCCATTTGCACTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021279.4-1792s21c1
Sequence:CCGGTGTGACCTCTTTGGGTATTATCTCGAGATAATACCCAAAGAGGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021279.4-1766s21c1
Sequence:CCGGGTTGCGGTTCCTGATGTATTTCTCGAGAAATACATCAGGAACCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021279
WNT1 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021279.3-2105s1c1
Sequence:CCGGGCGTTCGGTTATGTAAATAAACTCGAGTTTATTTACATAACCGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021279.3-348s1c1
Sequence:CCGGCTGGGTTTCTACTACGTTGCTCTCGAGAGCAACGTAGTAGAAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021279.3-1411s1c1
Sequence:CCGGCGCGTTCTGCACGAGTGTCTACTCGAGTAGACACTCGTGCAGAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021279.3-959s1c1
Sequence:CCGGAGATGCGCCAAGAGTGCAAATCTCGAGATTTGCACTCTTGGCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021279.4-602s21c1
Sequence:CCGGGCGAGAGTGCAAATGGCAATTCTCGAGAATTGCCATTTGCACTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021279.4-1792s21c1
Sequence:CCGGTGTGACCTCTTTGGGTATTATCTCGAGATAATACCCAAAGAGGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021279.4-1766s21c1
Sequence:CCGGGTTGCGGTTCCTGATGTATTTCTCGAGAAATACATCAGGAACCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks