EMAIL THIS PAGE TO A FRIEND

WNT2

wingless-type MMTV integration site family member 2

Synonyms: INT1L1 IRP
UniProtKB ID: P09544, Q75N05, Q9UDP9
Gene ID:
Human(7472) Summary: This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(22413) wingless-related MMTV integration site 2
Rat(114487) wingless-type MMTV integration site family member 2
domestic guinea pig(100135646) wingless-related MMTV integration site 2
domestic guinea pig(100719346) wingless-type MMTV integration site family member 2
Domestic Rabbit(100126569) wingless-type MMTV integration site family member 2
naked mole-rat(101723565) wingless-type MMTV integration site family member 2
cow(493729) wingless-type MMTV integration site family member 2
sheep(100126577) wingless-type MMTV integration site family member 2
fruit fly(35975) Wnt oncogene analog 2
Horse(100056092) wingless-type MMTV integration site family member 2
domestic cat(493672) wingless-type MMTV integration site family member 2
dog(612141) wingless-type MMTV integration site family member 2
chicken(417769) wingless-type MMTV integration site family member 2
Zebrafish(30127) wingless-type MMTV integration site family member 2
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU021201 MISSION® esiRNA esiRNA targeting mouse Wnt2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003391 Rosetta Predictions human pricing
XM_001059030 Rosetta Predictions rat pricing
XM_575397 Rosetta Predictions rat pricing
NM_023653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238135 predicted 1201
2 SASI_Hs01_00238136 predicted 1063
3 SASI_Hs01_00238137 predicted 470
4 SASI_Hs01_00238141 predicted 412
5 SASI_Hs02_00335572 predicted 1428
6 SASI_Hs02_00335573 predicted 1355
7 SASI_Hs02_00335574 predicted 1236
8 SASI_Hs01_00238142 predicted 1264
9 SASI_Hs01_00238143 predicted 1310
10 SASI_Hs01_00238144 predicted 1252
11 SASI_Hs01_00238138 predicted 1482
12 SASI_Hs01_00238139 predicted 1054
13 SASI_Hs01_00238140 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291661 predicted 1069
2 SASI_Rn02_00291662 predicted 1473
3 SASI_Rn02_00291663 predicted 770
4 SASI_Rn02_00291664 predicted 1200
5 SASI_Rn02_00291665 predicted 1541
6 SASI_Rn02_00291666 predicted 782
7 SASI_Rn02_00291667 predicted 415
8 SASI_Rn02_00291668 predicted 1578
9 SASI_Rn02_00291669 predicted 1536
10 SASI_Rn02_00291670 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403636 predicted 1478
2 SASI_Rn02_00403637 predicted 1041
3 SASI_Rn02_00403638 predicted 1433
4 SASI_Rn02_00403639 predicted 1409
5 SASI_Rn02_00403640 predicted 1798
6 SASI_Rn02_00403641 predicted 1353
7 SASI_Rn02_00403642 predicted 1753
8 SASI_Rn02_00403643 predicted 1710
9 SASI_Rn02_00403644 predicted 1537
10 SASI_Rn02_00403645 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160658 predicted 841
2 SASI_Mm01_00160659 predicted 1320
3 SASI_Mm01_00160660 predicted 978
4 SASI_Mm01_00160661 predicted 237
5 SASI_Mm01_00160662 predicted 831
6 SASI_Mm01_00160663 predicted 655
7 SASI_Mm01_00160664 predicted 1188
8 SASI_Mm01_00160665 predicted 562
9 SASI_Mm01_00160666 predicted 1357
10 SASI_Mm01_00160667 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003391
WNT2 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003391.2-1771s21c1
Sequence:CCGGCCACAAATGGTCCCAATTAAGCTCGAGCTTAATTGGGACCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003391.2-782s21c1
Sequence:CCGGTTGACTATGGGATCAAATTTGCTCGAGCAAATTTGATCCCATAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003391.2-615s21c1
Sequence:CCGGTCGGGAATCTGCCTTTGTTTACTCGAGTAAACAAAGGCAGATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-932s1c1
Sequence:CCGGGCTCATGTACTCTCAGGACATCTCGAGATGTCCTGAGAGTACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-469s1c1
Sequence:CCGGCCAGATGTGATGCGTGCCATTCTCGAGAATGGCACGCATCACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-798s1c1
Sequence:CCGGCCGCGCATTTGTGGATGCAAACTCGAGTTTGCATCCACAAATGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-671s1c1
Sequence:CCGGCCTGTAGCCAAGGAGAAGTAACTCGAGTTACTTCTCCTTGGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-1044s1c1
Sequence:CCGGCACAGGTTTCACTGTGGCTAACTCGAGTTAGCCACAGTGAAACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003391
WNT2 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003391.2-1771s21c1
Sequence:CCGGCCACAAATGGTCCCAATTAAGCTCGAGCTTAATTGGGACCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003391.2-782s21c1
Sequence:CCGGTTGACTATGGGATCAAATTTGCTCGAGCAAATTTGATCCCATAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003391.2-615s21c1
Sequence:CCGGTCGGGAATCTGCCTTTGTTTACTCGAGTAAACAAAGGCAGATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-932s1c1
Sequence:CCGGGCTCATGTACTCTCAGGACATCTCGAGATGTCCTGAGAGTACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-469s1c1
Sequence:CCGGCCAGATGTGATGCGTGCCATTCTCGAGAATGGCACGCATCACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-798s1c1
Sequence:CCGGCCGCGCATTTGTGGATGCAAACTCGAGTTTGCATCCACAAATGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-671s1c1
Sequence:CCGGCCTGTAGCCAAGGAGAAGTAACTCGAGTTACTTCTCCTTGGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-1044s1c1
Sequence:CCGGCACAGGTTTCACTGTGGCTAACTCGAGTTAGCCACAGTGAAACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003391
WNT2 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003391.2-1771s21c1
Sequence:CCGGCCACAAATGGTCCCAATTAAGCTCGAGCTTAATTGGGACCATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003391.2-782s21c1
Sequence:CCGGTTGACTATGGGATCAAATTTGCTCGAGCAAATTTGATCCCATAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003391.2-615s21c1
Sequence:CCGGTCGGGAATCTGCCTTTGTTTACTCGAGTAAACAAAGGCAGATTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-932s1c1
Sequence:CCGGGCTCATGTACTCTCAGGACATCTCGAGATGTCCTGAGAGTACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-469s1c1
Sequence:CCGGCCAGATGTGATGCGTGCCATTCTCGAGAATGGCACGCATCACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-798s1c1
Sequence:CCGGCCGCGCATTTGTGGATGCAAACTCGAGTTTGCATCCACAAATGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-671s1c1
Sequence:CCGGCCTGTAGCCAAGGAGAAGTAACTCGAGTTACTTCTCCTTGGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003391.1-1044s1c1
Sequence:CCGGCACAGGTTTCACTGTGGCTAACTCGAGTTAGCCACAGTGAAACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023653
WNT2 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023653.3-1833s1c1
Sequence:CCGGCCTTAGAAAGTGATTGCTATTCTCGAGAATAGCAATCACTTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-981s1c1
Sequence:CCGGGCGAAGTTATGTGTTGTGGGACTCGAGTCCCACAACACATAACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-341s1c1
Sequence:CCGGGACAGAGATCACAGCCTCTTTCTCGAGAAAGAGGCTGTGATCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-1030s1c1
Sequence:CCGGGATGACCAAGTGTGAGTGTAACTCGAGTTACACTCACACTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-139s1c1
Sequence:CCGGCAGCTCTTCATGGTGGTACATCTCGAGATGTACCACCATGAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-447s1c1
Sequence:CCGGCCTGTAGCCAAGGAGAATTAACTCGAGTTAATTCTCCTTGGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-763s1c1
Sequence:CCGGCGACTATCTCTGGAGGAAGTACTCGAGTACTTCCTCCAGAGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023653.3-1863s1c1
Sequence:CCGGCCCATCAGTTTAAGGATTCTTCTCGAGAAGAATCCTTAAACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-423s1c1
Sequence:CCGGGCGTTGTATTTGCCATCACCACTCGAGTGGTGATGGCAAATACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-831s1c1
Sequence:CCGGCTGTAGCCAATAAGAGGTTTACTCGAGTAAACCTCTTATTGGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023653
WNT2 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023653.3-1833s1c1
Sequence:CCGGCCTTAGAAAGTGATTGCTATTCTCGAGAATAGCAATCACTTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-981s1c1
Sequence:CCGGGCGAAGTTATGTGTTGTGGGACTCGAGTCCCACAACACATAACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-341s1c1
Sequence:CCGGGACAGAGATCACAGCCTCTTTCTCGAGAAAGAGGCTGTGATCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-1030s1c1
Sequence:CCGGGATGACCAAGTGTGAGTGTAACTCGAGTTACACTCACACTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-139s1c1
Sequence:CCGGCAGCTCTTCATGGTGGTACATCTCGAGATGTACCACCATGAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-447s1c1
Sequence:CCGGCCTGTAGCCAAGGAGAATTAACTCGAGTTAATTCTCCTTGGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-763s1c1
Sequence:CCGGCGACTATCTCTGGAGGAAGTACTCGAGTACTTCCTCCAGAGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023653.3-1863s1c1
Sequence:CCGGCCCATCAGTTTAAGGATTCTTCTCGAGAAGAATCCTTAAACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-423s1c1
Sequence:CCGGGCGTTGTATTTGCCATCACCACTCGAGTGGTGATGGCAAATACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-831s1c1
Sequence:CCGGCTGTAGCCAATAAGAGGTTTACTCGAGTAAACCTCTTATTGGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023653
WNT2 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023653.3-1833s1c1
Sequence:CCGGCCTTAGAAAGTGATTGCTATTCTCGAGAATAGCAATCACTTTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-981s1c1
Sequence:CCGGGCGAAGTTATGTGTTGTGGGACTCGAGTCCCACAACACATAACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-341s1c1
Sequence:CCGGGACAGAGATCACAGCCTCTTTCTCGAGAAAGAGGCTGTGATCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-1030s1c1
Sequence:CCGGGATGACCAAGTGTGAGTGTAACTCGAGTTACACTCACACTTGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-139s1c1
Sequence:CCGGCAGCTCTTCATGGTGGTACATCTCGAGATGTACCACCATGAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-447s1c1
Sequence:CCGGCCTGTAGCCAAGGAGAATTAACTCGAGTTAATTCTCCTTGGCTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-763s1c1
Sequence:CCGGCGACTATCTCTGGAGGAAGTACTCGAGTACTTCCTCCAGAGATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023653.3-1863s1c1
Sequence:CCGGCCCATCAGTTTAAGGATTCTTCTCGAGAAGAATCCTTAAACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-423s1c1
Sequence:CCGGGCGTTGTATTTGCCATCACCACTCGAGTGGTGATGGCAAATACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023653.3-831s1c1
Sequence:CCGGCTGTAGCCAATAAGAGGTTTACTCGAGTAAACCTCTTATTGGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks