EMAIL THIS PAGE TO A FRIEND

WNT2B

wingless-type MMTV integration site family, member 2B

Synonyms: WNT13 XWNT2
UniProtKB ID: Q93097, O14903, Q5TEI2, Q9HDC1, Q9HDC2
Gene ID:
Human(7482) Summary: This gene encodes a member of the wingless-type MMTV integration site (WNT) family of highly conserved, secreted signaling factors. WNT family members function in a variety of developmental processes including regulation of cell growth and differentiation and are characterized by a WNT-core domain. This gene may play a role in human development as well as human carcinogenesis. This gene produces two alternatively spliced transcript variants. [provided by RefSeq, Aug 2008]
Mouse(22414) wingless related MMTV integration site 2b
Rat(116466) wingless-type MMTV integration site family, member 2B
chicken(374243) wingless-type MMTV integration site family, member 2B
dog(483220) wingless-type MMTV integration site family, member 2B
domestic cat(101080904) wingless-type MMTV integration site family, member 2B
cow(445420) wingless-type MMTV integration site family, member 2B
sheep(101116782) wingless-type MMTV integration site family, member 2B
naked mole-rat(101704935) wingless-type MMTV integration site family, member 2B
Domestic Rabbit(100349847) wingless-type MMTV integration site family, member 2B
domestic guinea pig(100714996) wingless-type MMTV integration site family, member 2B
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024494 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004185 Rosetta Predictions human pricing
NM_024494 Rosetta Predictions human pricing
XM_001066411 Rosetta Predictions rat pricing
XM_342308 Rosetta Predictions rat pricing
NM_009520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125584 predicted 1466
2 SASI_Hs01_00125585 predicted 949
3 SASI_Hs01_00125586 predicted 1167
4 SASI_Hs01_00125587 predicted 1337
5 SASI_Hs02_00337068 predicted 1465
6 SASI_Hs01_00125588 predicted 1347
7 SASI_Hs01_00125589 predicted 975
8 SASI_Hs01_00125592 predicted 1528
9 SASI_Hs02_00337069 predicted 974
10 SASI_Hs02_00337070 predicted 1355
11 SASI_Hs01_00125590 predicted 1454
12 SASI_Hs01_00125591 predicted 1507
13 SASI_Hs01_00125593 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145963 predicted 1421
2 SASI_Hs01_00145964 predicted 902
3 SASI_Hs01_00145965 predicted 1128
4 SASI_Hs01_00145966 predicted 1299
5 SASI_Hs02_00356762 predicted 1418
6 SASI_Hs01_00145967 predicted 1302
7 SASI_Hs01_00145968 predicted 926
8 SASI_Hs01_00145971 predicted 1479
9 SASI_Hs02_00356763 predicted 936
10 SASI_Hs02_00356764 predicted 1305
11 SASI_Hs01_00145969 predicted 1405
12 SASI_Hs01_00145970 predicted 1471
13 SASI_Hs01_00145972 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317371 predicted 564
2 SASI_Rn02_00317372 predicted 668
3 SASI_Rn02_00317373 predicted 509
4 SASI_Rn02_00317374 predicted 1696
5 SASI_Rn02_00317375 predicted 1162
6 SASI_Rn02_00317376 predicted 1446
7 SASI_Rn02_00317377 predicted 1657
8 SASI_Rn02_00317378 predicted 1435
9 SASI_Rn02_00317379 predicted 1502
10 SASI_Rn02_00317380 predicted 1699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394087 predicted 922
2 SASI_Rn02_00394088 predicted 660
3 SASI_Rn02_00394089 predicted 409
4 SASI_Rn02_00394090 predicted 564
5 SASI_Rn02_00394091 predicted 515
6 SASI_Rn02_00394092 predicted 448
7 SASI_Rn02_00394093 predicted 685
8 SASI_Rn02_00394094 predicted 390
9 SASI_Rn02_00394095 predicted 543
10 SASI_Rn02_00394096 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189504 predicted 490
2 SASI_Mm01_00189505 predicted 1427
3 SASI_Mm01_00189506 predicted 1596
4 SASI_Mm01_00189507 predicted 800
5 SASI_Mm01_00189508 predicted 1340
6 SASI_Mm01_00189509 predicted 1116
7 SASI_Mm01_00189510 predicted 1674
8 SASI_Mm01_00189511 predicted 1244
9 SASI_Mm01_00189512 predicted 1672
10 SASI_Mm02_00316319 predicted 1670
11 SASI_Mm01_00189513 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024494
WNT2B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 2B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-905s1c1
Sequence:CCGGCGGACTGATCTTGTCTACTTTCTCGAGAAAGTAGACAAGATCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-663s1c1
Sequence:CCGGCCCTCATGAACTTACATAATACTCGAGTATTATGTAAGTTCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-232s1c1
Sequence:CCGGCTGTGACAATATCCCTGGTTTCTCGAGAAACCAGGGATATTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-221s1c1
Sequence:CCGGGCACGAGTGATCTGTGACAATCTCGAGATTGTCACAGATCACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-1115s1c1
Sequence:CCGGCGGTGCAAGGAATGCAGAAATCTCGAGATTTCTGCATTCCTTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024494.2-2178s21c1
Sequence:CCGGTAGGCTACCACATTCTATTATCTCGAGATAATAGAATGTGGTAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024494.2-685s21c1
Sequence:CCGGACACGTCCTGGTGGTACATTGCTCGAGCAATGTACCACCAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024494
WNT2B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 2B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-905s1c1
Sequence:CCGGCGGACTGATCTTGTCTACTTTCTCGAGAAAGTAGACAAGATCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-663s1c1
Sequence:CCGGCCCTCATGAACTTACATAATACTCGAGTATTATGTAAGTTCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-232s1c1
Sequence:CCGGCTGTGACAATATCCCTGGTTTCTCGAGAAACCAGGGATATTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-221s1c1
Sequence:CCGGGCACGAGTGATCTGTGACAATCTCGAGATTGTCACAGATCACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-1115s1c1
Sequence:CCGGCGGTGCAAGGAATGCAGAAATCTCGAGATTTCTGCATTCCTTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024494.2-2178s21c1
Sequence:CCGGTAGGCTACCACATTCTATTATCTCGAGATAATAGAATGTGGTAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024494.2-685s21c1
Sequence:CCGGACACGTCCTGGTGGTACATTGCTCGAGCAATGTACCACCAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024494
WNT2B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 2B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-905s1c1
Sequence:CCGGCGGACTGATCTTGTCTACTTTCTCGAGAAAGTAGACAAGATCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-663s1c1
Sequence:CCGGCCCTCATGAACTTACATAATACTCGAGTATTATGTAAGTTCATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-232s1c1
Sequence:CCGGCTGTGACAATATCCCTGGTTTCTCGAGAAACCAGGGATATTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-221s1c1
Sequence:CCGGGCACGAGTGATCTGTGACAATCTCGAGATTGTCACAGATCACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024494.1-1115s1c1
Sequence:CCGGCGGTGCAAGGAATGCAGAAATCTCGAGATTTCTGCATTCCTTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024494.2-2178s21c1
Sequence:CCGGTAGGCTACCACATTCTATTATCTCGAGATAATAGAATGTGGTAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024494.2-685s21c1
Sequence:CCGGACACGTCCTGGTGGTACATTGCTCGAGCAATGTACCACCAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009520
WNT2B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009520.2-2685s1c1
Sequence:CCGGCCCAGCTATTTACTCTCTATTCTCGAGAATAGAGAGTAAATAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-793s1c1
Sequence:CCGGCTGTAGTGACAACATCCATTACTCGAGTAATGGATGTTGTCACTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-1206s1c1
Sequence:CCGGGCAGCAAGACTTCTAAAGGAACTCGAGTTCCTTTAGAAGTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-478s1c1
Sequence:CCGGGCGGCAGTTGTGTCAACGCTACTCGAGTAGCGTTGACACAACTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-1117s1c1
Sequence:CCGGCCGGACTGATCTTGTCTACTTCTCGAGAAGTAGACAAGATCAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009520
WNT2B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009520.2-2685s1c1
Sequence:CCGGCCCAGCTATTTACTCTCTATTCTCGAGAATAGAGAGTAAATAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-793s1c1
Sequence:CCGGCTGTAGTGACAACATCCATTACTCGAGTAATGGATGTTGTCACTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-1206s1c1
Sequence:CCGGGCAGCAAGACTTCTAAAGGAACTCGAGTTCCTTTAGAAGTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-478s1c1
Sequence:CCGGGCGGCAGTTGTGTCAACGCTACTCGAGTAGCGTTGACACAACTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-1117s1c1
Sequence:CCGGCCGGACTGATCTTGTCTACTTCTCGAGAAGTAGACAAGATCAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009520
WNT2B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009520.2-2685s1c1
Sequence:CCGGCCCAGCTATTTACTCTCTATTCTCGAGAATAGAGAGTAAATAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-793s1c1
Sequence:CCGGCTGTAGTGACAACATCCATTACTCGAGTAATGGATGTTGTCACTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-1206s1c1
Sequence:CCGGGCAGCAAGACTTCTAAAGGAACTCGAGTTCCTTTAGAAGTCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-478s1c1
Sequence:CCGGGCGGCAGTTGTGTCAACGCTACTCGAGTAGCGTTGACACAACTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009520.2-1117s1c1
Sequence:CCGGCCGGACTGATCTTGTCTACTTCTCGAGAAGTAGACAAGATCAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks