EMAIL THIS PAGE TO A FRIEND

WNT3

wingless-type MMTV integration site family, member 3

Synonyms: INT4
UniProtKB ID: P56703, Q2M237, Q9H1J9
Gene ID:
Human(7473) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]
Mouse(22415) wingless-related MMTV integration site 3
Rat(24882) wingless-type MMTV integration site family, member 3
Zebrafish(569420) wingless-type MMTV integration site family, member 3
Horse(100049880) wingless-type MMTV integration site family, member 3
domestic cat(101088533) wingless-type MMTV integration site family, member 3
dog(609107) wingless-type MMTV integration site family, member 3
chicken(374142) wingless-type MMTV integration site family, member 3
domestic guinea pig(100734613) wingless-type MMTV integration site family, member 3
Domestic Rabbit(100009033) wingless-type MMTV integration site family, member 3
naked mole-rat(101724651) wingless-type MMTV integration site family, member 3
cow(540753) wingless-type MMTV integration site family, member 3
sheep(101120096) wingless-type MMTV integration site family, member 3
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030753 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144961 MISSION® esiRNA esiRNA human WNT3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030753 Rosetta Predictions human pricing
NM_001105715 Rosetta Predictions rat pricing
NM_009521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246696 predicted 608
2 SASI_Hs01_00246697 predicted 279
3 SASI_Hs01_00246698 predicted 382
4 SASI_Hs01_00246699 predicted 537
5 SASI_Hs01_00246700 predicted 1226
6 SASI_Hs01_00246702 predicted 596
7 SASI_Hs01_00246703 predicted 599
8 SASI_Hs01_00246704 predicted 1071
9 SASI_Hs01_00246705 predicted 378
10 SASI_Hs02_00358267 predicted 896
11 SASI_Hs01_00246701 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211816 predicted 956
2 SASI_Rn02_00211817 predicted 579
3 SASI_Rn02_00211818 predicted 578
4 SASI_Rn02_00211819 predicted 621
5 SASI_Rn02_00211820 predicted 626
6 SASI_Rn02_00211821 predicted 820
7 SASI_Rn02_00211822 predicted 370
8 SASI_Rn02_00211823 predicted 303
9 SASI_Rn02_00211824 predicted 595
10 SASI_Rn02_00211825 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133269 predicted 644
2 SASI_Mm01_00133270 predicted 817
3 SASI_Mm01_00133271 predicted 574
4 SASI_Mm01_00133274 predicted 1165
5 SASI_Mm01_00133275 predicted 1168
6 SASI_Mm01_00133276 predicted 624
7 SASI_Mm02_00316320 predicted 820
8 SASI_Mm02_00316321 predicted 992
9 SASI_Mm01_00133277 predicted 1143
10 SASI_Mm01_00133278 predicted 206
11 SASI_Mm01_00133272 predicted 342
12 SASI_Mm01_00133273 predicted 597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030753
VALIDATED
WNT3 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_030753.3-716s21c1
Sequence:CCGGGGACCACATGCACCTCAAATGCTCGAGCATTTGAGGTGCATGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030753.3-175s21c1
Sequence:CCGGTCCTCGCTGGCTACCCAATTTCTCGAGAAATTGGGTAGCCAGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030753.3-1319s1c1
Sequence:CCGGTGGTAAATGACCCAGACCCAACTCGAGTTGGGTCTGGGTCATTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_030753.3-1145s1c1
Sequence:CCGGCCAGGAGTGTATTCGCATCTACTCGAGTAGATGCGAATACACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_030753.3-1073s1c1
Sequence:CCGGCCACAACACGAGGACGGAGAACTCGAGTTCTCCGTCCTCGTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030753.3-536s1c1
Sequence:CCGGCGGCTGTGACTCGCATCATAACTCGAGTTATGATGCGAGTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030753.3-296s1c1
Sequence:CCGGCCGCAATTACATCGAGATCATCTCGAGATGATCTCGATGTAATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030753
VALIDATED
WNT3 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_030753.3-716s21c1
Sequence:CCGGGGACCACATGCACCTCAAATGCTCGAGCATTTGAGGTGCATGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030753.3-175s21c1
Sequence:CCGGTCCTCGCTGGCTACCCAATTTCTCGAGAAATTGGGTAGCCAGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030753.3-1319s1c1
Sequence:CCGGTGGTAAATGACCCAGACCCAACTCGAGTTGGGTCTGGGTCATTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_030753.3-1145s1c1
Sequence:CCGGCCAGGAGTGTATTCGCATCTACTCGAGTAGATGCGAATACACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_030753.3-1073s1c1
Sequence:CCGGCCACAACACGAGGACGGAGAACTCGAGTTCTCCGTCCTCGTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030753.3-536s1c1
Sequence:CCGGCGGCTGTGACTCGCATCATAACTCGAGTTATGATGCGAGTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030753.3-296s1c1
Sequence:CCGGCCGCAATTACATCGAGATCATCTCGAGATGATCTCGATGTAATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030753
VALIDATED
WNT3 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_030753.3-716s21c1
Sequence:CCGGGGACCACATGCACCTCAAATGCTCGAGCATTTGAGGTGCATGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030753.3-175s21c1
Sequence:CCGGTCCTCGCTGGCTACCCAATTTCTCGAGAAATTGGGTAGCCAGCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030753.3-1319s1c1
Sequence:CCGGTGGTAAATGACCCAGACCCAACTCGAGTTGGGTCTGGGTCATTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_030753.3-1145s1c1
Sequence:CCGGCCAGGAGTGTATTCGCATCTACTCGAGTAGATGCGAATACACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_030753.3-1073s1c1
Sequence:CCGGCCACAACACGAGGACGGAGAACTCGAGTTCTCCGTCCTCGTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030753.3-536s1c1
Sequence:CCGGCGGCTGTGACTCGCATCATAACTCGAGTTATGATGCGAGTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030753.3-296s1c1
Sequence:CCGGCCGCAATTACATCGAGATCATCTCGAGATGATCTCGATGTAATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009521
WNT3 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000071498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009521.1-462s1c1
Sequence:CCGGCGGCTGTGACTCACATCATAACTCGAGTTATGATGTGAGTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009521.1-1071s1c1
Sequence:CCGGCCAAGAGTGTATTCGCATCTACTCGAGTAGATGCGAATACACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009521.1-598s1c1
Sequence:CCGGGCTATGAACAAGCACAACAATCTCGAGATTGTTGTGCTTGTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009521
WNT3 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000071498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009521.1-462s1c1
Sequence:CCGGCGGCTGTGACTCACATCATAACTCGAGTTATGATGTGAGTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009521.1-1071s1c1
Sequence:CCGGCCAAGAGTGTATTCGCATCTACTCGAGTAGATGCGAATACACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009521.1-598s1c1
Sequence:CCGGGCTATGAACAAGCACAACAATCTCGAGATTGTTGTGCTTGTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009521
WNT3 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000071498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009521.1-462s1c1
Sequence:CCGGCGGCTGTGACTCACATCATAACTCGAGTTATGATGTGAGTCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009521.1-1071s1c1
Sequence:CCGGCCAAGAGTGTATTCGCATCTACTCGAGTAGATGCGAATACACTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009521.1-598s1c1
Sequence:CCGGGCTATGAACAAGCACAACAATCTCGAGATTGTTGTGCTTGTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks