EMAIL THIS PAGE TO A FRIEND

WNT3A

wingless-type MMTV integration site family, member 3A

UniProtKB ID: P56704, Q3SY79, Q3SY80, Q969P2
Gene ID:
Human(89780) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 96% amino acid identity to mouse Wnt3A protein, and 84% to human WNT3 protein, another WNT gene product. This gene is clustered with WNT14 gene, another family member, in chromosome 1q42 region. [provided by RefSeq, Jul 2008]
Mouse(22416) wingless-related MMTV integration site 3A
Rat(303181) wingless-type MMTV integration site family, member 3A
cow(522467) wingless-type MMTV integration site family, member 3A
sheep(101123374) wingless-type MMTV integration site family, member 3A
naked mole-rat(101716074) wingless-type MMTV integration site family, member 3A
Domestic Rabbit(100354583) wingless-type MMTV integration site family, member 3A
domestic guinea pig(100726694) wingless-type MMTV integration site family, member 3A
Zebrafish(60632) wingless-type MMTV integration site family, member 3A
chicken(395396) wingless-type MMTV integration site family, member 3A
dog(482208) wingless-type MMTV integration site family, member 3A
domestic cat(101080607) wingless-type MMTV integration site family, member 3A
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033131 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048091 MISSION® esiRNA esiRNA targeting mouse Wnt3a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033131 Rosetta Predictions human pricing
NM_001107005 Rosetta Predictions rat pricing
NM_009522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196831 predicted 555
2 SASI_Hs01_00196832 predicted 622
3 SASI_Hs01_00196833 predicted 909
4 SASI_Hs01_00196834 predicted 602
5 SASI_Hs01_00196835 predicted 617
6 SASI_Hs01_00196837 predicted 244
7 SASI_Hs01_00196838 predicted 556
8 SASI_Hs01_00196839 predicted 1020
9 SASI_Hs02_00360861 predicted 600
10 SASI_Hs02_00360862 predicted 537
11 SASI_Hs01_00196836 predicted 401
12 SASI_Hs01_00196840 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224546 predicted 1442
2 SASI_Rn02_00224547 predicted 892
3 SASI_Rn02_00224548 predicted 525
4 SASI_Rn02_00224549 predicted 467
5 SASI_Rn02_00224550 predicted 546
6 SASI_Rn02_00224551 predicted 752
7 SASI_Rn02_00224552 predicted 397
8 SASI_Rn02_00224553 predicted 1310
9 SASI_Rn02_00224554 predicted 975
10 SASI_Rn02_00224555 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103726 predicted 730
2 SASI_Mm01_00103728 predicted 1640
3 SASI_Mm01_00103730 predicted 954
4 SASI_Mm01_00103731 predicted 1473
5 SASI_Mm01_00103732 predicted 1066
6 SASI_Mm01_00103733 predicted 1607
7 SASI_Mm01_00103734 predicted 1174
8 SASI_Mm01_00103735 predicted 1512
9 SASI_Mm02_00316322 predicted 599
10 SASI_Mm02_00316323 predicted 582
11 SASI_Mm01_00103727 predicted 1287
12 SASI_Mm01_00103729 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009522
WNT3A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 3A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009522.1-2258s1c1
Sequence:CCGGCCTCACTTTGAGTTGTATGAACTCGAGTTCATACAACTCAAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-713s1c1
Sequence:CCGGCGCCAGTCACATGCACCTCAACTCGAGTTGAGGTGCATGTGACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-959s1c1
Sequence:CCGGACCCAACTTCTGCGAACCTAACTCGAGTTAGGTTCGCAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-591s1c1
Sequence:CCGGTGTAGTGAGGACATTGAATTTCTCGAGAAATTCAATGTCCTCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-899s1c1
Sequence:CCGGGCCACGTTACACGTACTTCAACTCGAGTTGAAGTACGTGTAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009522
WNT3A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 3A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009522.1-2258s1c1
Sequence:CCGGCCTCACTTTGAGTTGTATGAACTCGAGTTCATACAACTCAAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-713s1c1
Sequence:CCGGCGCCAGTCACATGCACCTCAACTCGAGTTGAGGTGCATGTGACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-959s1c1
Sequence:CCGGACCCAACTTCTGCGAACCTAACTCGAGTTAGGTTCGCAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-591s1c1
Sequence:CCGGTGTAGTGAGGACATTGAATTTCTCGAGAAATTCAATGTCCTCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-899s1c1
Sequence:CCGGGCCACGTTACACGTACTTCAACTCGAGTTGAAGTACGTGTAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009522
WNT3A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 3A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009522.1-2258s1c1
Sequence:CCGGCCTCACTTTGAGTTGTATGAACTCGAGTTCATACAACTCAAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-713s1c1
Sequence:CCGGCGCCAGTCACATGCACCTCAACTCGAGTTGAGGTGCATGTGACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-959s1c1
Sequence:CCGGACCCAACTTCTGCGAACCTAACTCGAGTTAGGTTCGCAGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-591s1c1
Sequence:CCGGTGTAGTGAGGACATTGAATTTCTCGAGAAATTCAATGTCCTCACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009522.1-899s1c1
Sequence:CCGGGCCACGTTACACGTACTTCAACTCGAGTTGAAGTACGTGTAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033131
WNT3A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 3A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000256995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033131.2-440s21c1
Sequence:CCGGCCTTTGCAGTGACACGCTCATCTCGAGATGAGCGTGTCACTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033131.2-2500s21c1
Sequence:CCGGCCAGAGCTGCTGGTCTCATTTCTCGAGAAATGAGACCAGCAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033131.2-542s21c1
Sequence:CCGGGTAGCGAGGACATCGAGTTTGCTCGAGCAAACTCGATGTCCTCGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033131.2-248s21c1
Sequence:CCGGGGAACTACGTGGAGATCATGCCTCGAGGCATGATCTCCACGTAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033131
WNT3A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 3A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000256995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033131.2-440s21c1
Sequence:CCGGCCTTTGCAGTGACACGCTCATCTCGAGATGAGCGTGTCACTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033131.2-2500s21c1
Sequence:CCGGCCAGAGCTGCTGGTCTCATTTCTCGAGAAATGAGACCAGCAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033131.2-542s21c1
Sequence:CCGGGTAGCGAGGACATCGAGTTTGCTCGAGCAAACTCGATGTCCTCGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033131.2-248s21c1
Sequence:CCGGGGAACTACGTGGAGATCATGCCTCGAGGCATGATCTCCACGTAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033131
WNT3A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 3A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000256995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033131.2-440s21c1
Sequence:CCGGCCTTTGCAGTGACACGCTCATCTCGAGATGAGCGTGTCACTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033131.2-2500s21c1
Sequence:CCGGCCAGAGCTGCTGGTCTCATTTCTCGAGAAATGAGACCAGCAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033131.2-542s21c1
Sequence:CCGGGTAGCGAGGACATCGAGTTTGCTCGAGCAAACTCGATGTCCTCGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033131.2-248s21c1
Sequence:CCGGGGAACTACGTGGAGATCATGCCTCGAGGCATGATCTCCACGTAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks