EMAIL THIS PAGE TO A FRIEND

WNT4

wingless-type MMTV integration site family, member 4

Synonyms: SERKAL WNT-4
UniProtKB ID: P56705, Q5TZQ0, Q96T81, Q9BXF5, Q9H1J8, Q9UJM2
Gene ID:
Human(54361) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and is the first signaling molecule shown to influence the sex-determination cascade. It encodes a protein which shows 98% amino acid identity to the Wnt4 protein of mouse and rat. This gene and a nuclear receptor known to antagonize the testis-determining factor play a concerted role in both the control of female development and the prevention of testes formation. This gene and another two family members, WNT2 and WNT7B, may be associated with abnormal proliferation in breast tissue. Mutations in this gene can result in Rokitansky-Kuster-Hauser syndrome and in SERKAL syndrome. [provided by RefSeq, Jul 2008]
Mouse(22417) wingless-related MMTV integration site 4
Rat(84426) wingless-type MMTV integration site family, member 4
fruit fly(34007) Wnt oncogene analog 4
chicken(395561) wingless-type MMTV integration site family, member 4
domestic cat(101095185) wingless-type MMTV integration site family, member 4
Horse(100071678) wingless-type MMTV integration site family, member 4
dog(612367) wingless-type MMTV integration site family, member 4
domestic guinea pig(100724855) wingless-type MMTV integration site family, member 4
naked mole-rat(101701972) wingless-type MMTV integration site family, member 4
cow(789600) wingless-type MMTV integration site family, member 4
sheep(101122423) wingless-type MMTV integration site family, member 4
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1778 Human Wnt-4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030761 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030761 Rosetta Predictions human pricing
NM_053402 Rosetta Predictions rat pricing
NM_009523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358283 predicted 1593
2 SASI_Hs02_00358284 predicted 1427
3 SASI_Hs02_00358285 predicted 1643
4 SASI_Hs02_00358286 predicted 910
5 SASI_Hs02_00358287 predicted 1419
6 SASI_Hs02_00358288 predicted 1473
7 SASI_Hs02_00358289 predicted 1280
8 SASI_Hs02_00358290 predicted 1461
9 SASI_Hs02_00358291 predicted 1422
10 SASI_Hs02_00358292 predicted 1065
11 SASI_Hs01_00135560 predicted 1275
12 SASI_Hs01_00135561 predicted 994
13 SASI_Hs01_00135562 predicted 899
14 SASI_Hs01_00135563 predicted 413
15 SASI_Hs01_00135564 predicted 791
16 SASI_Hs01_00135565 predicted 433
17 SASI_Hs01_00135566 predicted 976
18 SASI_Hs01_00135567 predicted 604
19 SASI_Hs01_00135568 predicted 460
20 SASI_Hs01_00135569 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104506 predicted 370
2 SASI_Rn01_00104507 predicted 695
3 SASI_Rn01_00104509 predicted 766
4 SASI_Rn01_00104510 predicted 219
5 SASI_Rn01_00104511 predicted 651
6 SASI_Rn02_00265904 predicted 796
7 SASI_Rn01_00104512 predicted 783
8 SASI_Rn01_00104513 predicted 548
9 SASI_Rn01_00104514 predicted 884
10 SASI_Rn01_00104515 predicted 476
11 SASI_Rn01_00104508 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103911 predicted 595
2 SASI_Mm01_00103912 predicted 531
3 SASI_Mm01_00103913 predicted 838
4 SASI_Mm01_00103914 predicted 722
5 SASI_Mm01_00103915 predicted 406
6 SASI_Mm01_00103917 predicted 259
7 SASI_Mm01_00103918 predicted 822
8 SASI_Mm01_00103919 predicted 196
9 SASI_Mm01_00103920 predicted 866
10 SASI_Mm02_00316324 predicted 220
11 SASI_Mm01_00103916 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030761
WNT4 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-903s21c1
Sequence:CCGGGATGAGGACCTGGTGTACTTGCTCGAGCAAGTACACCAGGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-738s21c1
Sequence:CCGGTCAGGCTCCTGTGAGGTAAAGCTCGAGCTTTACCTCACAGGAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-592s21c1
Sequence:CCGGTGGCCTTCTCACAGTCGTTTGCTCGAGCAAACGACTGTGAGAAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-987s21c1
Sequence:CCGGACATGCAACAAGACGTCCAAGCTCGAGCTTGGACGTCTTGTTGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030761.3-1331s1c1
Sequence:CCGGCCCAAGAGATACTGGTTGTATCTCGAGATACAACCAGTATCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030761.3-651s1c1
Sequence:CCGGGTCAGGATGCTCTGACAACATCTCGAGATGTTGTCAGAGCATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030761.3-892s1c1
Sequence:CCGGGCACTGAAGGAGAAGTTTGATCTCGAGATCAAACTTCTCCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030761.3-889s1c1
Sequence:CCGGCACGCACTGAAGGAGAAGTTTCTCGAGAAACTTCTCCTTCAGTGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030761
WNT4 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-903s21c1
Sequence:CCGGGATGAGGACCTGGTGTACTTGCTCGAGCAAGTACACCAGGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-738s21c1
Sequence:CCGGTCAGGCTCCTGTGAGGTAAAGCTCGAGCTTTACCTCACAGGAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-592s21c1
Sequence:CCGGTGGCCTTCTCACAGTCGTTTGCTCGAGCAAACGACTGTGAGAAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-987s21c1
Sequence:CCGGACATGCAACAAGACGTCCAAGCTCGAGCTTGGACGTCTTGTTGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030761.3-1331s1c1
Sequence:CCGGCCCAAGAGATACTGGTTGTATCTCGAGATACAACCAGTATCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030761.3-651s1c1
Sequence:CCGGGTCAGGATGCTCTGACAACATCTCGAGATGTTGTCAGAGCATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030761.3-892s1c1
Sequence:CCGGGCACTGAAGGAGAAGTTTGATCTCGAGATCAAACTTCTCCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030761.3-889s1c1
Sequence:CCGGCACGCACTGAAGGAGAAGTTTCTCGAGAAACTTCTCCTTCAGTGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030761
WNT4 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-903s21c1
Sequence:CCGGGATGAGGACCTGGTGTACTTGCTCGAGCAAGTACACCAGGTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-738s21c1
Sequence:CCGGTCAGGCTCCTGTGAGGTAAAGCTCGAGCTTTACCTCACAGGAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-592s21c1
Sequence:CCGGTGGCCTTCTCACAGTCGTTTGCTCGAGCAAACGACTGTGAGAAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030761.4-987s21c1
Sequence:CCGGACATGCAACAAGACGTCCAAGCTCGAGCTTGGACGTCTTGTTGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030761.3-1331s1c1
Sequence:CCGGCCCAAGAGATACTGGTTGTATCTCGAGATACAACCAGTATCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030761.3-651s1c1
Sequence:CCGGGTCAGGATGCTCTGACAACATCTCGAGATGTTGTCAGAGCATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030761.3-892s1c1
Sequence:CCGGGCACTGAAGGAGAAGTTTGATCTCGAGATCAAACTTCTCCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030761.3-889s1c1
Sequence:CCGGCACGCACTGAAGGAGAAGTTTCTCGAGAAACTTCTCCTTCAGTGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009523
VALIDATED
WNT4 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-928s21c1
Sequence:CCGGACGTGCAACAAGACATCTAAACTCGAGTTTAGATGTCTTGTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-208s21c1
Sequence:CCGGCAGATGTGCAAACGGAACCTTCTCGAGAAGGTTCCGTTTGCACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-159s21c1
Sequence:CCGGCGAAGAGGAGACGTGCGAGAACTCGAGTTCTCGCACGTCTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-813s21c1
Sequence:CCGGGCCTCGGAATGCACAGTTCAACTCGAGTTGAACTGTGCATTCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-739s1c1
Sequence:CCGGCACGCGCTAAAGGAGAAGTTTCTCGAGAAACTTCTCCTTTAGCGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009523.1-208s1c1
Sequence:CCGGCAGATGTGCAAACGGAACCTTCTCGAGAAGGTTCCGTTTGCACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-159s1c1
Sequence:CCGGCGAAGAGGAGACGTGCGAGAACTCGAGTTCTCGCACGTCTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-813s1c1
Sequence:CCGGGCCTCGGAATGCACAGTTCAACTCGAGTTGAACTGTGCATTCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-928s1c1
Sequence:CCGGACGTGCAACAAGACATCTAAACTCGAGTTTAGATGTCTTGTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009523
VALIDATED
WNT4 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-928s21c1
Sequence:CCGGACGTGCAACAAGACATCTAAACTCGAGTTTAGATGTCTTGTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-208s21c1
Sequence:CCGGCAGATGTGCAAACGGAACCTTCTCGAGAAGGTTCCGTTTGCACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-159s21c1
Sequence:CCGGCGAAGAGGAGACGTGCGAGAACTCGAGTTCTCGCACGTCTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-813s21c1
Sequence:CCGGGCCTCGGAATGCACAGTTCAACTCGAGTTGAACTGTGCATTCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-739s1c1
Sequence:CCGGCACGCGCTAAAGGAGAAGTTTCTCGAGAAACTTCTCCTTTAGCGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009523.1-208s1c1
Sequence:CCGGCAGATGTGCAAACGGAACCTTCTCGAGAAGGTTCCGTTTGCACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-159s1c1
Sequence:CCGGCGAAGAGGAGACGTGCGAGAACTCGAGTTCTCGCACGTCTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-813s1c1
Sequence:CCGGGCCTCGGAATGCACAGTTCAACTCGAGTTGAACTGTGCATTCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-928s1c1
Sequence:CCGGACGTGCAACAAGACATCTAAACTCGAGTTTAGATGTCTTGTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009523
VALIDATED
WNT4 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-928s21c1
Sequence:CCGGACGTGCAACAAGACATCTAAACTCGAGTTTAGATGTCTTGTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-208s21c1
Sequence:CCGGCAGATGTGCAAACGGAACCTTCTCGAGAAGGTTCCGTTTGCACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-159s21c1
Sequence:CCGGCGAAGAGGAGACGTGCGAGAACTCGAGTTCTCGCACGTCTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009523.1-813s21c1
Sequence:CCGGGCCTCGGAATGCACAGTTCAACTCGAGTTGAACTGTGCATTCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-739s1c1
Sequence:CCGGCACGCGCTAAAGGAGAAGTTTCTCGAGAAACTTCTCCTTTAGCGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009523.1-208s1c1
Sequence:CCGGCAGATGTGCAAACGGAACCTTCTCGAGAAGGTTCCGTTTGCACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-159s1c1
Sequence:CCGGCGAAGAGGAGACGTGCGAGAACTCGAGTTCTCGCACGTCTCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-813s1c1
Sequence:CCGGGCCTCGGAATGCACAGTTCAACTCGAGTTGAACTGTGCATTCCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009523.1-928s1c1
Sequence:CCGGACGTGCAACAAGACATCTAAACTCGAGTTTAGATGTCTTGTTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks