EMAIL THIS PAGE TO A FRIEND

WNT5A

wingless-type MMTV integration site family, member 5A

Synonyms: hWNT5A
UniProtKB ID: P41221, A8K4A4, Q6P278
Gene ID:
Human(7474) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(22418) wingless-related MMTV integration site 5A
Rat(64566) wingless-type MMTV integration site family, member 5A
Zebrafish(568191) wingless-type MMTV integration site family, member 5a
chicken(395703) wingless-type MMTV integration site family, member 5A
dog(484721) wingless-type MMTV integration site family, member 5A
cow(530005) wingless-type MMTV integration site family, member 5A
sheep(101109745) wingless-type MMTV integration site family, member 5A
naked mole-rat(101711272) wingless-type MMTV integration site family, member 5A
domestic guinea pig(100723890) wingless-type MMTV integration site family, member 5A
216 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108739 Anti-WNT5A affinity isolated antibody mouse, canine, guinea pig, horse, rat, rabbit, human, pig, zebrafish
immunohistochemistry, western blot pricing
SAB4301921 Anti-WNT5A affinity isolated antibody human, mouse, rat
immunohistochemistry pricing
SAB2102714 Anti-WNT5A antibody produced in rabbit affinity isolated antibody horse, rat, mouse, human, guinea pig, rabbit, bovine, rabbit
western blot pricing
SAB1411396 Anti-WNT5A antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300183 Monoclonal Anti-WNT5A antibody produced in mouse clone 6F2, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300184 Monoclonal Anti-WNT5A antibody produced in mouse clone 3D10, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB1402393 Monoclonal Anti-WNT5A antibody produced in mouse clone 3A4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003392 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003392 Rosetta Predictions human pricing
NM_022631 Rosetta Predictions rat pricing
NM_009524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202618 predicted 615
2 SASI_Hs01_00202619 predicted 477
3 SASI_Hs01_00202620 predicted 1231
4 SASI_Hs02_00335575 predicted 448
5 SASI_Hs01_00202621 predicted 630
6 SASI_Hs02_00335576 predicted 1045
7 SASI_Hs01_00202623 predicted 637
8 SASI_Hs01_00202624 predicted 428
9 SASI_Hs01_00202625 predicted 396
10 SASI_Hs01_00202626 predicted 445
11 SASI_Hs01_00202617 predicted 673
12 SASI_Hs01_00202622 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037578 predicted 1741
2 SASI_Rn01_00037579 predicted 307
3 SASI_Rn01_00037581 predicted 873
4 SASI_Rn01_00037582 predicted 356
5 SASI_Rn01_00037583 predicted 1734
6 SASI_Rn01_00037584 predicted 302
7 SASI_Rn01_00037585 predicted 475
8 SASI_Rn01_00037586 predicted 527
9 SASI_Rn01_00037587 predicted 295
10 SASI_Rn02_00263420 predicted 400
11 SASI_Rn01_00037580 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056405 predicted 1660
2 SASI_Mm01_00056406 predicted 1659
3 SASI_Mm01_00056407 predicted 1333
4 SASI_Mm01_00056408 predicted 804
5 SASI_Mm01_00056409 predicted 766
6 SASI_Mm01_00056410 predicted 1238
7 SASI_Mm01_00056411 predicted 697
8 SASI_Mm01_00056412 predicted 1543
9 SASI_Mm01_00056413 predicted 730
10 SASI_Mm01_00056414 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009524
VALIDATED
WNT5A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 5A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009524.2-1756s1c1
Sequence:CCGGGTGGATCAGTTCGTGTGCAAACTCGAGTTTGCACACGAACTGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009524.2-885s1c1
Sequence:CCGGCCACTTGTATCAGGACCACATCTCGAGATGTGGTCCTGATACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009524.2-1230s1c1
Sequence:CCGGCGCTAGAGAAAGGGAACGAATCTCGAGATTCGTTCCCTTTCTCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009524.2-763s1c1
Sequence:CCGGGCTAATTCTTGGTGGTCTCTACTCGAGTAGAGACCACCAAGAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009524.2-704s1c1
Sequence:CCGGCCAAGTTCTTCCTAATGGCTTCTCGAGAAGCCATTAGGAAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009524
VALIDATED
WNT5A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 5A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009524.2-1756s1c1
Sequence:CCGGGTGGATCAGTTCGTGTGCAAACTCGAGTTTGCACACGAACTGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009524.2-885s1c1
Sequence:CCGGCCACTTGTATCAGGACCACATCTCGAGATGTGGTCCTGATACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009524.2-1230s1c1
Sequence:CCGGCGCTAGAGAAAGGGAACGAATCTCGAGATTCGTTCCCTTTCTCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009524.2-763s1c1
Sequence:CCGGGCTAATTCTTGGTGGTCTCTACTCGAGTAGAGACCACCAAGAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009524.2-704s1c1
Sequence:CCGGCCAAGTTCTTCCTAATGGCTTCTCGAGAAGCCATTAGGAAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009524
VALIDATED
WNT5A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 5A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009524.2-1756s1c1
Sequence:CCGGGTGGATCAGTTCGTGTGCAAACTCGAGTTTGCACACGAACTGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009524.2-885s1c1
Sequence:CCGGCCACTTGTATCAGGACCACATCTCGAGATGTGGTCCTGATACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009524.2-1230s1c1
Sequence:CCGGCGCTAGAGAAAGGGAACGAATCTCGAGATTCGTTCCCTTTCTCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009524.2-763s1c1
Sequence:CCGGGCTAATTCTTGGTGGTCTCTACTCGAGTAGAGACCACCAAGAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009524.2-704s1c1
Sequence:CCGGCCAAGTTCTTCCTAATGGCTTCTCGAGAAGCCATTAGGAAGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003392
VALIDATED
WNT5A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 5A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003392.3-583s1c1
Sequence:CCGGCACATGCAGTACATCGGAGAACTCGAGTTCTCCGATGTACTGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003392.3-478s1c1
Sequence:CCGGCCTGTTCAGATGTCAGAAGTACTCGAGTACTTCTGACATCTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003392.3-429s1c1
Sequence:CCGGCCAGGTTGTAATTGAAGCCAACTCGAGTTGGCTTCAATTACAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003392.3-867s1c1
Sequence:CCGGCGACAACATCGACTATGGCTACTCGAGTAGCCATAGTCGATGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-397s21c1
Sequence:CCGGCTAGTGGCTTTGGCCATATTTCTCGAGAAATATGGCCAAAGCCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-478s21c1
Sequence:CCGGCCTGTTCAGATGTCAGAAGTACTCGAGTACTTCTGACATCTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-621s21c1
Sequence:CCGGCAAAGAATGCCAGTATCAATTCTCGAGAATTGATACTGGCATTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-1488s21c1
Sequence:CCGGCTCCCAGGACCCGCTTATTTACTCGAGTAAATAAGCGGGTCCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003392
VALIDATED
WNT5A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 5A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003392.3-583s1c1
Sequence:CCGGCACATGCAGTACATCGGAGAACTCGAGTTCTCCGATGTACTGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003392.3-478s1c1
Sequence:CCGGCCTGTTCAGATGTCAGAAGTACTCGAGTACTTCTGACATCTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003392.3-429s1c1
Sequence:CCGGCCAGGTTGTAATTGAAGCCAACTCGAGTTGGCTTCAATTACAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003392.3-867s1c1
Sequence:CCGGCGACAACATCGACTATGGCTACTCGAGTAGCCATAGTCGATGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-397s21c1
Sequence:CCGGCTAGTGGCTTTGGCCATATTTCTCGAGAAATATGGCCAAAGCCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-478s21c1
Sequence:CCGGCCTGTTCAGATGTCAGAAGTACTCGAGTACTTCTGACATCTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-621s21c1
Sequence:CCGGCAAAGAATGCCAGTATCAATTCTCGAGAATTGATACTGGCATTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-1488s21c1
Sequence:CCGGCTCCCAGGACCCGCTTATTTACTCGAGTAAATAAGCGGGTCCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003392
VALIDATED
WNT5A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 5A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003392.3-583s1c1
Sequence:CCGGCACATGCAGTACATCGGAGAACTCGAGTTCTCCGATGTACTGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003392.3-478s1c1
Sequence:CCGGCCTGTTCAGATGTCAGAAGTACTCGAGTACTTCTGACATCTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003392.3-429s1c1
Sequence:CCGGCCAGGTTGTAATTGAAGCCAACTCGAGTTGGCTTCAATTACAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003392.3-867s1c1
Sequence:CCGGCGACAACATCGACTATGGCTACTCGAGTAGCCATAGTCGATGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-397s21c1
Sequence:CCGGCTAGTGGCTTTGGCCATATTTCTCGAGAAATATGGCCAAAGCCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-478s21c1
Sequence:CCGGCCTGTTCAGATGTCAGAAGTACTCGAGTACTTCTGACATCTGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-621s21c1
Sequence:CCGGCAAAGAATGCCAGTATCAATTCTCGAGAATTGATACTGGCATTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003392.3-1488s21c1
Sequence:CCGGCTCCCAGGACCCGCTTATTTACTCGAGTAAATAAGCGGGTCCTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks