EMAIL THIS PAGE TO A FRIEND

WNT5B

wingless-type MMTV integration site family, member 5B

UniProtKB ID: Q9H1J7, A8K315, D3DUP9, Q96S49, Q9BV04
Gene ID:
Human(81029) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 94% and 80% amino acid identity to the mouse Wnt5b protein and the human WNT5A protein, respectively. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Mouse(22419) wingless-related MMTV integration site 5B
Rat(282582) wingless-type MMTV integration site family, member 5B
Zebrafish(30105) wingless-type MMTV integration site family, member 5b
chicken(418154) wingless-type MMTV integration site family, member 5B
domestic cat(101085809) wingless-type MMTV integration site family, member 5B
dog(486756) wingless-type MMTV integration site family, member 5B
domestic guinea pig(100715484) wingless-type MMTV integration site family, member 5B
naked mole-rat(101696315) wingless-type MMTV integration site family, member 5B
Domestic Rabbit(100349579) wingless-type MMTV integration site family, member 5B
cow(508008) wingless-type MMTV integration site family, member 5B
sheep(101121415) wingless-type MMTV integration site family, member 5B
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032642 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059661 MISSION® esiRNA esiRNA human WNT5B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030775 Rosetta Predictions human pricing
NM_032642 Rosetta Predictions human pricing
NM_001100489 Rosetta Predictions rat pricing
NM_009525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134350 predicted 1641
2 SASI_Hs02_00358317 predicted 1662
3 SASI_Hs01_00134351 predicted 445
4 SASI_Hs01_00134352 predicted 1546
5 SASI_Hs01_00134353 predicted 473
6 SASI_Hs01_00134354 predicted 411
7 SASI_Hs01_00134355 predicted 682
8 SASI_Hs01_00134357 predicted 1651
9 SASI_Hs01_00134358 predicted 317
10 SASI_Hs01_00134359 predicted 1678
11 SASI_Hs01_00134356 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213333 predicted 1677
2 SASI_Hs02_00360197 predicted 1699
3 SASI_Hs01_00213334 predicted 479
4 SASI_Hs01_00213335 predicted 1582
5 SASI_Hs01_00213336 predicted 511
6 SASI_Hs01_00213337 predicted 456
7 SASI_Hs01_00213338 predicted 726
8 SASI_Hs01_00213340 predicted 1687
9 SASI_Hs01_00213341 predicted 358
10 SASI_Hs01_00213342 predicted 1714
11 SASI_Hs01_00213339 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209874 predicted 1365
2 SASI_Rn02_00209875 predicted 1442
3 SASI_Rn02_00209876 predicted 1045
4 SASI_Rn02_00209877 predicted 725
5 SASI_Rn02_00209878 predicted 919
6 SASI_Rn02_00209879 predicted 1248
7 SASI_Rn02_00209880 predicted 1260
8 SASI_Rn02_00209881 predicted 952
9 SASI_Rn02_00209882 predicted 361
10 SASI_Rn02_00209883 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111083 predicted 1042
2 SASI_Mm01_00111084 predicted 667
3 SASI_Mm02_00316325 predicted 1387
4 SASI_Mm01_00111085 predicted 504
5 SASI_Mm01_00111086 predicted 1743
6 SASI_Mm02_00316326 predicted 1276
7 SASI_Mm01_00111088 predicted 1186
8 SASI_Mm01_00111090 predicted 488
9 SASI_Mm02_00316327 predicted 1755
10 SASI_Mm01_00111091 predicted 1244
11 SASI_Mm01_00111087 predicted 1642
12 SASI_Mm01_00111089 predicted 1022
13 SASI_Mm01_00111092 predicted 1648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032642
WNT5B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 5B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032642.2-459s21c1
Sequence:CCGGGAATTGCAGCACAGCGGACAACTCGAGTTGTCCGCTGTGCTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032642.2-1393s21c1
Sequence:CCGGGGAAAGGAAGAGCTTATTTAACTCGAGTTAAATAAGCTCTTCCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032642.2-1355s21c1
Sequence:CCGGGTAAATGGGTGGGTGCTATACCTCGAGGTATAGCACCCACCCATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032642.2-1298s1c1
Sequence:CCGGGCCTCACAAAGGTCTATATTACTCGAGTAATATAGACCTTTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-808s1c1
Sequence:CCGGGTGTATAAGATGGCAGACGTACTCGAGTACGTCTGCCATCTTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-728s1c1
Sequence:CCGGAGAAGAACTTTGCCAAAGGATCTCGAGATCCTTTGGCAAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-1240s1c1
Sequence:CCGGGTGGACCAGTACATCTGTAAACTCGAGTTTACAGATGTACTGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-292s1c1
Sequence:CCGGCCCGAGATGTTTATCATCGGTCTCGAGACCGATGATAAACATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032642
WNT5B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 5B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032642.2-459s21c1
Sequence:CCGGGAATTGCAGCACAGCGGACAACTCGAGTTGTCCGCTGTGCTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032642.2-1393s21c1
Sequence:CCGGGGAAAGGAAGAGCTTATTTAACTCGAGTTAAATAAGCTCTTCCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032642.2-1355s21c1
Sequence:CCGGGTAAATGGGTGGGTGCTATACCTCGAGGTATAGCACCCACCCATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032642.2-1298s1c1
Sequence:CCGGGCCTCACAAAGGTCTATATTACTCGAGTAATATAGACCTTTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-808s1c1
Sequence:CCGGGTGTATAAGATGGCAGACGTACTCGAGTACGTCTGCCATCTTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-728s1c1
Sequence:CCGGAGAAGAACTTTGCCAAAGGATCTCGAGATCCTTTGGCAAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-1240s1c1
Sequence:CCGGGTGGACCAGTACATCTGTAAACTCGAGTTTACAGATGTACTGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-292s1c1
Sequence:CCGGCCCGAGATGTTTATCATCGGTCTCGAGACCGATGATAAACATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032642
WNT5B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 5B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032642.2-459s21c1
Sequence:CCGGGAATTGCAGCACAGCGGACAACTCGAGTTGTCCGCTGTGCTGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032642.2-1393s21c1
Sequence:CCGGGGAAAGGAAGAGCTTATTTAACTCGAGTTAAATAAGCTCTTCCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032642.2-1355s21c1
Sequence:CCGGGTAAATGGGTGGGTGCTATACCTCGAGGTATAGCACCCACCCATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123194    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032642.2-1298s1c1
Sequence:CCGGGCCTCACAAAGGTCTATATTACTCGAGTAATATAGACCTTTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-808s1c1
Sequence:CCGGGTGTATAAGATGGCAGACGTACTCGAGTACGTCTGCCATCTTATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-728s1c1
Sequence:CCGGAGAAGAACTTTGCCAAAGGATCTCGAGATCCTTTGGCAAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-1240s1c1
Sequence:CCGGGTGGACCAGTACATCTGTAAACTCGAGTTTACAGATGTACTGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032642.2-292s1c1
Sequence:CCGGCCCGAGATGTTTATCATCGGTCTCGAGACCGATGATAAACATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009525
WNT5B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 5B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-724s21c1
Sequence:CCGGATCTGTCTTTGGCAGAGTTATCTCGAGATAACTCTGCCAAAGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-1278s21c1
Sequence:CCGGCTGACTACTGCCTGCGTAATGCTCGAGCATTACGCAGGCAGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009525.3-1808s21c1
Sequence:GTACCGGGATGAAGGAACTGGACTTATTCTCGAGAATAAGTCCAGTTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-930s21c1
Sequence:CCGGACCGCTTTGCCAAGGAGTTTGCTCGAGCAAACTCCTTGGCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-531s21c1
Sequence:CCGGGACCGGAGATGTTCATCATTGCTCGAGCAATGATGAACATCTCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-792s1c1
Sequence:CCGGGCCGTGTATAAGATGGCTGATCTCGAGATCAGCCATCTTATACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-275s1c1
Sequence:CCGGGAGACCGGAGATGTTCATCATCTCGAGATGATGAACATCTCCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-1190s1c1
Sequence:CCGGGTGTTGCTTTGTCAGATGCAACTCGAGTTGCATCTGACAAAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-1023s1c1
Sequence:CCGGCCTGACTACTGCTTGCGTAATCTCGAGATTACGCAAGCAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-705s1c1
Sequence:CCGGCGAGAGCGTGAGAAGAACTTTCTCGAGAAAGTTCTTCTCACGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009525
WNT5B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 5B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-724s21c1
Sequence:CCGGATCTGTCTTTGGCAGAGTTATCTCGAGATAACTCTGCCAAAGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-1278s21c1
Sequence:CCGGCTGACTACTGCCTGCGTAATGCTCGAGCATTACGCAGGCAGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009525.3-1808s21c1
Sequence:GTACCGGGATGAAGGAACTGGACTTATTCTCGAGAATAAGTCCAGTTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-930s21c1
Sequence:CCGGACCGCTTTGCCAAGGAGTTTGCTCGAGCAAACTCCTTGGCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-531s21c1
Sequence:CCGGGACCGGAGATGTTCATCATTGCTCGAGCAATGATGAACATCTCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-792s1c1
Sequence:CCGGGCCGTGTATAAGATGGCTGATCTCGAGATCAGCCATCTTATACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-275s1c1
Sequence:CCGGGAGACCGGAGATGTTCATCATCTCGAGATGATGAACATCTCCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-1190s1c1
Sequence:CCGGGTGTTGCTTTGTCAGATGCAACTCGAGTTGCATCTGACAAAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-1023s1c1
Sequence:CCGGCCTGACTACTGCTTGCGTAATCTCGAGATTACGCAAGCAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-705s1c1
Sequence:CCGGCGAGAGCGTGAGAAGAACTTTCTCGAGAAAGTTCTTCTCACGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009525
WNT5B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 5B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-724s21c1
Sequence:CCGGATCTGTCTTTGGCAGAGTTATCTCGAGATAACTCTGCCAAAGACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-1278s21c1
Sequence:CCGGCTGACTACTGCCTGCGTAATGCTCGAGCATTACGCAGGCAGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009525.3-1808s21c1
Sequence:GTACCGGGATGAAGGAACTGGACTTATTCTCGAGAATAAGTCCAGTTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-930s21c1
Sequence:CCGGACCGCTTTGCCAAGGAGTTTGCTCGAGCAAACTCCTTGGCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009525.3-531s21c1
Sequence:CCGGGACCGGAGATGTTCATCATTGCTCGAGCAATGATGAACATCTCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-792s1c1
Sequence:CCGGGCCGTGTATAAGATGGCTGATCTCGAGATCAGCCATCTTATACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-275s1c1
Sequence:CCGGGAGACCGGAGATGTTCATCATCTCGAGATGATGAACATCTCCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-1190s1c1
Sequence:CCGGGTGTTGCTTTGTCAGATGCAACTCGAGTTGCATCTGACAAAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-1023s1c1
Sequence:CCGGCCTGACTACTGCTTGCGTAATCTCGAGATTACGCAAGCAGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009525.2-705s1c1
Sequence:CCGGCGAGAGCGTGAGAAGAACTTTCTCGAGAAAGTTCTTCTCACGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks