EMAIL THIS PAGE TO A FRIEND

WNT6

wingless-type MMTV integration site family, member 6

UniProtKB ID: Q9Y6F9, Q9H1J6, Q9H238
Gene ID:
Human(7475) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is overexpressed in cervical cancer cell line and strongly coexpressed with another family member, WNT10A, in colorectal cancer cell line. The gene overexpression may play key roles in carcinogenesis. This gene and the WNT10A gene are clustered in the chromosome 2q35 region. The protein encoded by this gene is 97% identical to the mouse Wnt6 protein at the amino acid level. [provided by RefSeq, Jul 2008]
Mouse(22420) wingless-related MMTV integration site 6
Rat(316526) wingless-type MMTV integration site family, member 6
cow(505075) wingless-type MMTV integration site family, member 6
sheep(101111785) wingless-type MMTV integration site family, member 6
naked mole-rat(101698823) wingless-type MMTV integration site family, member 6
domestic guinea pig(100713618) wingless-type MMTV integration site family, member 6
fruit fly(34010) Wnt oncogene analog 6
chicken(395235) wingless-type MMTV integration site family, member 6
domestic cat(101099392) wingless-type MMTV integration site family, member 6
dog(488527) wingless-type MMTV integration site family, member 6
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006522 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU008511 MISSION® esiRNA esiRNA targeting mouse Wnt6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006522 Rosetta Predictions human pricing
NM_001108226 Rosetta Predictions rat pricing
NM_009526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014623 predicted 1127
2 SASI_Hs01_00014624 predicted 908
3 SASI_Hs01_00014625 predicted 1073
4 SASI_Hs01_00014626 predicted 1236
5 SASI_Hs01_00014627 predicted 1266
6 SASI_Hs01_00014628 predicted 1311
7 SASI_Hs01_00014629 predicted 1045
8 SASI_Hs01_00014630 predicted 1227
9 SASI_Hs01_00014631 predicted 953
10 SASI_Hs01_00014632 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236564 predicted 1652
2 SASI_Rn02_00236565 predicted 1431
3 SASI_Rn02_00236566 predicted 900
4 SASI_Rn02_00236567 predicted 1756
5 SASI_Rn02_00236568 predicted 590
6 SASI_Rn02_00236569 predicted 1025
7 SASI_Rn02_00236570 predicted 1007
8 SASI_Rn02_00236571 predicted 614
9 SASI_Rn02_00236572 predicted 944
10 SASI_Rn02_00236573 predicted 1744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316328 predicted 723
2 SASI_Mm01_00087621 predicted 910
3 SASI_Mm02_00316329 predicted 846
4 SASI_Mm01_00087623 predicted 792
5 SASI_Mm01_00087624 predicted 600
6 SASI_Mm01_00087625 predicted 436
7 SASI_Mm01_00087626 predicted 1384
8 SASI_Mm01_00087627 predicted 1024
9 SASI_Mm01_00087628 predicted 630
10 SASI_Mm01_00087629 predicted 828
11 SASI_Mm01_00087620 predicted 725
12 SASI_Mm01_00087622 predicted 1391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009526
WNT6 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-840s1c1
Sequence:CCGGCGCACCGAGTGTAAGTGCCATCTCGAGATGGCACTTACACTCGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-1043s1c1
Sequence:CCGGCGCAGCCGATTCACCCGACTTCTCGAGAAGTCGGGTGAATCGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-766s1c1
Sequence:CCGGGCCGTGGAGATATCCGTGCATCTCGAGATGCACGGATATCTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-360s1c1
Sequence:CCGGCCGGAAGTAGTGGCAGAGCTTCTCGAGAAGCTCTGCCACTACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-495s1c1
Sequence:CCGGGAGACAGCTTTCGTGTTTGCACTCGAGTGCAAACACGAAAGCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009526
WNT6 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-840s1c1
Sequence:CCGGCGCACCGAGTGTAAGTGCCATCTCGAGATGGCACTTACACTCGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-1043s1c1
Sequence:CCGGCGCAGCCGATTCACCCGACTTCTCGAGAAGTCGGGTGAATCGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-766s1c1
Sequence:CCGGGCCGTGGAGATATCCGTGCATCTCGAGATGCACGGATATCTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-360s1c1
Sequence:CCGGCCGGAAGTAGTGGCAGAGCTTCTCGAGAAGCTCTGCCACTACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-495s1c1
Sequence:CCGGGAGACAGCTTTCGTGTTTGCACTCGAGTGCAAACACGAAAGCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009526
WNT6 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-840s1c1
Sequence:CCGGCGCACCGAGTGTAAGTGCCATCTCGAGATGGCACTTACACTCGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-1043s1c1
Sequence:CCGGCGCAGCCGATTCACCCGACTTCTCGAGAAGTCGGGTGAATCGGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-766s1c1
Sequence:CCGGGCCGTGGAGATATCCGTGCATCTCGAGATGCACGGATATCTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-360s1c1
Sequence:CCGGCCGGAAGTAGTGGCAGAGCTTCTCGAGAAGCTCTGCCACTACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009526.2-495s1c1
Sequence:CCGGGAGACAGCTTTCGTGTTTGCACTCGAGTGCAAACACGAAAGCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006522
WNT6 MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006522.3-1530s1c1
Sequence:CCGGGAGCGTTTAAAGGACACTGTACTCGAGTACAGTGTCCTTTAAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-501s1c1
Sequence:CCGGCGCATCCTGCAACAGGACATTCTCGAGAATGTCCTGTTGCAGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-323s1c1
Sequence:CCGGCCCTACCAGCATCTGCAGGAACTCGAGTTCCTGCAGATGCTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-815s1c1
Sequence:CCGGGTTGGTGCAACTGCACAACAACTCGAGTTGTTGTGCAGTTGCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-755s1c1
Sequence:CCGGCGAGAAGTCGAGGCTCTTTATCTCGAGATAAAGAGCCTCGACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006522.3-310s21c1
Sequence:CCGGCCTTGGTTATGGACCCTACCACTCGAGTGGTAGGGTCCATAACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006522.3-865s21c1
Sequence:CCGGACACGCGCACCGAGTGCAAATCTCGAGATTTGCACTCGGTGCGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006522.3-1211s21c1
Sequence:CCGGGAGCGTGCAGCTCGAAGAGAACTCGAGTTCTCTTCGAGCTGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006522
WNT6 MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006522.3-1530s1c1
Sequence:CCGGGAGCGTTTAAAGGACACTGTACTCGAGTACAGTGTCCTTTAAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-501s1c1
Sequence:CCGGCGCATCCTGCAACAGGACATTCTCGAGAATGTCCTGTTGCAGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-323s1c1
Sequence:CCGGCCCTACCAGCATCTGCAGGAACTCGAGTTCCTGCAGATGCTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-815s1c1
Sequence:CCGGGTTGGTGCAACTGCACAACAACTCGAGTTGTTGTGCAGTTGCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-755s1c1
Sequence:CCGGCGAGAAGTCGAGGCTCTTTATCTCGAGATAAAGAGCCTCGACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006522.3-310s21c1
Sequence:CCGGCCTTGGTTATGGACCCTACCACTCGAGTGGTAGGGTCCATAACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006522.3-865s21c1
Sequence:CCGGACACGCGCACCGAGTGCAAATCTCGAGATTTGCACTCGGTGCGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006522.3-1211s21c1
Sequence:CCGGGAGCGTGCAGCTCGAAGAGAACTCGAGTTCTCTTCGAGCTGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006522
WNT6 MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006522.3-1530s1c1
Sequence:CCGGGAGCGTTTAAAGGACACTGTACTCGAGTACAGTGTCCTTTAAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-501s1c1
Sequence:CCGGCGCATCCTGCAACAGGACATTCTCGAGAATGTCCTGTTGCAGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-323s1c1
Sequence:CCGGCCCTACCAGCATCTGCAGGAACTCGAGTTCCTGCAGATGCTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-815s1c1
Sequence:CCGGGTTGGTGCAACTGCACAACAACTCGAGTTGTTGTGCAGTTGCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006522.3-755s1c1
Sequence:CCGGCGAGAAGTCGAGGCTCTTTATCTCGAGATAAAGAGCCTCGACTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006522.3-310s21c1
Sequence:CCGGCCTTGGTTATGGACCCTACCACTCGAGTGGTAGGGTCCATAACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006522.3-865s21c1
Sequence:CCGGACACGCGCACCGAGTGCAAATCTCGAGATTTGCACTCGGTGCGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006522.3-1211s21c1
Sequence:CCGGGAGCGTGCAGCTCGAAGAGAACTCGAGTTCTCTTCGAGCTGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks