EMAIL THIS PAGE TO A FRIEND

WNT7A

wingless-type MMTV integration site family, member 7A

UniProtKB ID: O00755, Q96H90, Q9Y560
Gene ID:
Human(7476) Summary: This gene is a member of the WNT gene family, which consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is involved in the development of the anterior-posterior axis in the female reproductive tract, and also plays a critical role in uterine smooth muscle pattering and maintenance of adult uterine function. Mutations in this gene are associated with Fuhrmann and Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndromes. [provided by RefSeq, Jul 2008]
Mouse(22421) wingless-related MMTV integration site 7A
Rat(114850) wingless-type MMTV integration site family, member 7A
chicken(374168) wingless-type MMTV integration site family, member 7A
Horse(100055450) wingless-type MMTV integration site family, member 7A
domestic cat(101083664) wingless-type MMTV integration site family, member 7A
dog(607180) wingless-type MMTV integration site family, member 7A
domestic guinea pig(100719106) wingless-type MMTV integration site family, member 7A
naked mole-rat(101725735) wingless-type MMTV integration site family, member 7A
Domestic Rabbit(100355697) wingless-type MMTV integration site family, member 7A
cow(533782) wingless-type MMTV integration site family, member 7A
sheep(101109917) wingless-type MMTV integration site family, member 7A
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015719 Anti-WNT7A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2700308 Anti-WNT7A antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2900694 Anti-WNT7A antibody produced in rabbit affinity isolated antibody dog, hamster, pig, monkey, chicken, horse, Xenopus, bovine, guinea pig, rat, rabbit, mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004625 Rosetta Predictions human pricing
XM_001062984 Rosetta Predictions rat pricing
XM_001073352 Rosetta Predictions rat pricing
XM_001073379 Rosetta Predictions rat pricing
XM_342723 Rosetta Predictions rat pricing
NM_009527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202327 predicted 1004
2 SASI_Hs01_00202328 predicted 685
3 SASI_Hs01_00202329 predicted 613
4 SASI_Hs02_00338022 predicted 911
5 SASI_Hs01_00202331 predicted 1044
6 SASI_Hs01_00202332 predicted 515
7 SASI_Hs01_00202333 predicted 545
8 SASI_Hs01_00202334 predicted 609
9 SASI_Hs01_00202335 predicted 573
10 SASI_Hs01_00202336 predicted 821
11 SASI_Hs01_00202330 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305349 predicted 420
2 SASI_Rn02_00305350 predicted 1466
3 SASI_Rn02_00305351 predicted 348
4 SASI_Rn02_00305352 predicted 420
5 SASI_Rn02_00305353 predicted 1430
6 SASI_Rn02_00305354 predicted 297
7 SASI_Rn02_00305355 predicted 447
8 SASI_Rn02_00305356 predicted 470
9 SASI_Rn02_00305357 predicted 430
10 SASI_Rn02_00305358 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342505 predicted 427
2 SASI_Rn02_00342506 predicted 519
3 SASI_Rn02_00342507 predicted 1626
4 SASI_Rn02_00342508 predicted 449
5 SASI_Rn02_00342509 predicted 1277
6 SASI_Rn02_00342510 predicted 1279
7 SASI_Rn02_00342511 predicted 1324
8 SASI_Rn02_00342512 predicted 468
9 SASI_Rn02_00342513 predicted 768
10 SASI_Rn02_00342514 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342595 predicted 424
2 SASI_Rn02_00342596 predicted 519
3 SASI_Rn02_00342597 predicted 1635
4 SASI_Rn02_00342598 predicted 446
5 SASI_Rn02_00342599 predicted 1284
6 SASI_Rn02_00342600 predicted 1283
7 SASI_Rn02_00342601 predicted 1324
8 SASI_Rn02_00342602 predicted 469
9 SASI_Rn02_00342603 predicted 771
10 SASI_Rn02_00342604 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394721 predicted 428
2 SASI_Rn02_00394722 predicted 1470
3 SASI_Rn02_00394723 predicted 348
4 SASI_Rn02_00394724 predicted 426
5 SASI_Rn02_00394725 predicted 1429
6 SASI_Rn02_00394726 predicted 299
7 SASI_Rn02_00394727 predicted 447
8 SASI_Rn02_00394728 predicted 467
9 SASI_Rn02_00394729 predicted 429
10 SASI_Rn02_00394730 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085701 predicted 424
2 SASI_Mm02_00316330 predicted 287
3 SASI_Mm01_00085703 predicted 476
4 SASI_Mm01_00085704 predicted 1590
5 SASI_Mm01_00085705 predicted 1285
6 SASI_Mm01_00085707 predicted 448
7 SASI_Mm01_00085708 predicted 1284
8 SASI_Mm01_00085709 predicted 1587
9 SASI_Mm01_00085710 predicted 442
10 SASI_Mm02_00316331 predicted 1074
11 SASI_Mm01_00085702 predicted 1618
12 SASI_Mm01_00085706 predicted 1627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004625
WNT7A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 7A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004625.3-402s21c1
Sequence:CCGGGGCGCAAGCATCATCTGTAACCTCGAGGTTACAGATGATGCTTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004625.3-580s21c1
Sequence:CCGGTCTTCGGGAAGGAGCTCAAAGCTCGAGCTTTGAGCTCCTTCCCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004625.3-1332s21c1
Sequence:CCGGACGGAGATGTACACGTGCAAGCTCGAGCTTGCACGTGTACATCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-1064s1c1
Sequence:CCGGGATCAAGAAGCCACTGTCGTACTCGAGTACGACAGTGGCTTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-471s1c1
Sequence:CCGGCCCGACGCCATCATCGTCATACTCGAGTATGACGATGATGGCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-488s1c1
Sequence:CCGGCATAGGAGAAGGCTCACAAATCTCGAGATTTGTGAGCCTTCTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-618s1c1
Sequence:CCGGGCGTTCACCTACGCCATCATTCTCGAGAATGATGGCGTAGGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-983s1c1
Sequence:CCGGCGTGCTCAAGGACAAGTACAACTCGAGTTGTACTTGTCCTTGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004625
WNT7A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 7A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004625.3-402s21c1
Sequence:CCGGGGCGCAAGCATCATCTGTAACCTCGAGGTTACAGATGATGCTTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004625.3-580s21c1
Sequence:CCGGTCTTCGGGAAGGAGCTCAAAGCTCGAGCTTTGAGCTCCTTCCCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004625.3-1332s21c1
Sequence:CCGGACGGAGATGTACACGTGCAAGCTCGAGCTTGCACGTGTACATCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-1064s1c1
Sequence:CCGGGATCAAGAAGCCACTGTCGTACTCGAGTACGACAGTGGCTTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-471s1c1
Sequence:CCGGCCCGACGCCATCATCGTCATACTCGAGTATGACGATGATGGCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-488s1c1
Sequence:CCGGCATAGGAGAAGGCTCACAAATCTCGAGATTTGTGAGCCTTCTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-618s1c1
Sequence:CCGGGCGTTCACCTACGCCATCATTCTCGAGAATGATGGCGTAGGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-983s1c1
Sequence:CCGGCGTGCTCAAGGACAAGTACAACTCGAGTTGTACTTGTCCTTGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004625
WNT7A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 7A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004625.3-402s21c1
Sequence:CCGGGGCGCAAGCATCATCTGTAACCTCGAGGTTACAGATGATGCTTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004625.3-580s21c1
Sequence:CCGGTCTTCGGGAAGGAGCTCAAAGCTCGAGCTTTGAGCTCCTTCCCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004625.3-1332s21c1
Sequence:CCGGACGGAGATGTACACGTGCAAGCTCGAGCTTGCACGTGTACATCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-1064s1c1
Sequence:CCGGGATCAAGAAGCCACTGTCGTACTCGAGTACGACAGTGGCTTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-471s1c1
Sequence:CCGGCCCGACGCCATCATCGTCATACTCGAGTATGACGATGATGGCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-488s1c1
Sequence:CCGGCATAGGAGAAGGCTCACAAATCTCGAGATTTGTGAGCCTTCTCCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-618s1c1
Sequence:CCGGGCGTTCACCTACGCCATCATTCTCGAGAATGATGGCGTAGGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004625.3-983s1c1
Sequence:CCGGCGTGCTCAAGGACAAGTACAACTCGAGTTGTACTTGTCCTTGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009527
WNT7A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 7A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-478s1c1
Sequence:CCGGTGTCAGTTTCAGTTCCGAAATCTCGAGATTTCGGAACTGAAACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-1289s1c1
Sequence:CCGGCGGAGATGTATACGTGCAAGTCTCGAGACTTGCACGTATACATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-942s1c1
Sequence:CCGGGCTCAAGGACAAATACAACGACTCGAGTCGTTGTATTTGTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-792s1c1
Sequence:CCGGGACGCTCATGAACTTACACAACTCGAGTTGTGTAAGTTCATGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-360s1c1
Sequence:CCGGTGCGAGCATCATCTGTAACAACTCGAGTTGTTACAGATGATGCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009527
WNT7A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 7A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-478s1c1
Sequence:CCGGTGTCAGTTTCAGTTCCGAAATCTCGAGATTTCGGAACTGAAACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-1289s1c1
Sequence:CCGGCGGAGATGTATACGTGCAAGTCTCGAGACTTGCACGTATACATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-942s1c1
Sequence:CCGGGCTCAAGGACAAATACAACGACTCGAGTCGTTGTATTTGTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-792s1c1
Sequence:CCGGGACGCTCATGAACTTACACAACTCGAGTTGTGTAAGTTCATGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-360s1c1
Sequence:CCGGTGCGAGCATCATCTGTAACAACTCGAGTTGTTACAGATGATGCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009527
WNT7A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 7A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-478s1c1
Sequence:CCGGTGTCAGTTTCAGTTCCGAAATCTCGAGATTTCGGAACTGAAACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-1289s1c1
Sequence:CCGGCGGAGATGTATACGTGCAAGTCTCGAGACTTGCACGTATACATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-942s1c1
Sequence:CCGGGCTCAAGGACAAATACAACGACTCGAGTCGTTGTATTTGTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-792s1c1
Sequence:CCGGGACGCTCATGAACTTACACAACTCGAGTTGTGTAAGTTCATGAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009527.2-360s1c1
Sequence:CCGGTGCGAGCATCATCTGTAACAACTCGAGTTGTTACAGATGATGCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks