EMAIL THIS PAGE TO A FRIEND

WNT7B

wingless-type MMTV integration site family, member 7B

UniProtKB ID: P56706, B8A596, Q96Q12
Gene ID:
Human(7477) Summary: This gene is a member of the WNT gene family, which consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Among members of the human WNT family, this gene product is most similar to WNT7A protein. [provided by RefSeq, Oct 2008]
Mouse(22422) wingless-related MMTV integration site 7B
Rat(315196) wingless-type MMTV integration site family, member 7B
chicken(427937) wingless-type MMTV integration site family, member 7B
dog(481206) wingless-type MMTV integration site family, member 7B
domestic cat(101095592) wingless-type MMTV integration site family, member 7B
cow(525135) wingless-type MMTV integration site family, member 7B
naked mole-rat(101726616) wingless-type MMTV integration site family, member 7B
domestic guinea pig(100726062) wingless-type MMTV integration site family, member 7B
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_058238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058238 Rosetta Predictions human pricing
NM_001009695 Rosetta Predictions rat pricing
XM_579312 Rosetta Predictions rat pricing
NM_009528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362144 predicted 1239
2 SASI_Hs01_00098838 predicted 887
3 SASI_Hs01_00098839 predicted 1164
4 SASI_Hs01_00098840 predicted 1466
5 SASI_Hs01_00098841 predicted 284
6 SASI_Hs01_00098842 predicted 887
7 SASI_Hs01_00098843 predicted 866
8 SASI_Hs01_00098844 predicted 836
9 SASI_Hs01_00098845 predicted 1470
10 SASI_Hs01_00098846 predicted 405
11 SASI_Hs01_00098837 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075705 predicted 497
2 SASI_Rn01_00075706 predicted 742
3 SASI_Rn01_00075707 predicted 416
4 SASI_Rn01_00075708 predicted 231
5 SASI_Rn01_00075709 predicted 465
6 SASI_Rn01_00075710 predicted 588
7 SASI_Rn01_00075711 predicted 264
8 SASI_Rn02_00199754 predicted 669
9 SASI_Rn01_00075712 predicted 402
10 SASI_Rn01_00075713 predicted 407
11 SASI_Rn01_00075714 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145301 predicted 542
2 SASI_Rn01_00145302 predicted 726
3 SASI_Rn01_00145303 predicted 681
4 SASI_Rn01_00145304 predicted 545
5 SASI_Rn01_00145305 predicted 542
6 SASI_Rn01_00145306 predicted 527
7 SASI_Rn01_00145307 predicted 675
8 SASI_Rn01_00145308 predicted 702
9 SASI_Rn01_00145309 predicted 573
10 SASI_Rn01_00145310 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316332 predicted 1120
2 SASI_Mm01_00033690 predicted 321
3 SASI_Mm01_00033691 predicted 525
4 SASI_Mm01_00033692 predicted 1343
5 SASI_Mm01_00033693 predicted 897
6 SASI_Mm01_00033694 predicted 1085
7 SASI_Mm01_00033695 predicted 541
8 SASI_Mm01_00033697 predicted 1424
9 SASI_Mm01_00033698 predicted 1621
10 SASI_Mm01_00033699 predicted 1582
11 SASI_Mm01_00033696 predicted 1464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009528
WNT7B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 7B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-897s1c1
Sequence:CCGGGCAGCTACGCAGCTACCAGAACTCGAGTTCTGGTAGCTGCGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-201s1c1
Sequence:CCGGCGGAGCATTGTCATCCGTGGTCTCGAGACCACGGATGACAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-783s1c1
Sequence:CCGGGCTACCTAAGTTCCGCGAGGTCTCGAGACCTCGCGGAACTTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-297s1c1
Sequence:CCGGACCCGATGCCATCATTGTGATCTCGAGATCACAATGATGGCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009528.2-2070s1c1
Sequence:CCGGCGGCTCTGTGAAATAAATATACTCGAGTATATTTATTTCACAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009528
WNT7B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 7B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-897s1c1
Sequence:CCGGGCAGCTACGCAGCTACCAGAACTCGAGTTCTGGTAGCTGCGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-201s1c1
Sequence:CCGGCGGAGCATTGTCATCCGTGGTCTCGAGACCACGGATGACAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-783s1c1
Sequence:CCGGGCTACCTAAGTTCCGCGAGGTCTCGAGACCTCGCGGAACTTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-297s1c1
Sequence:CCGGACCCGATGCCATCATTGTGATCTCGAGATCACAATGATGGCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009528.2-2070s1c1
Sequence:CCGGCGGCTCTGTGAAATAAATATACTCGAGTATATTTATTTCACAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009528
WNT7B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 7B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-897s1c1
Sequence:CCGGGCAGCTACGCAGCTACCAGAACTCGAGTTCTGGTAGCTGCGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-201s1c1
Sequence:CCGGCGGAGCATTGTCATCCGTGGTCTCGAGACCACGGATGACAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-783s1c1
Sequence:CCGGGCTACCTAAGTTCCGCGAGGTCTCGAGACCTCGCGGAACTTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009528.2-297s1c1
Sequence:CCGGACCCGATGCCATCATTGTGATCTCGAGATCACAATGATGGCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009528.2-2070s1c1
Sequence:CCGGCGGCTCTGTGAAATAAATATACTCGAGTATATTTATTTCACAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058238
VALIDATED
WNT7B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 7B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-560s1c1
Sequence:CCGGCGTGCGTTACGGCATCGACTTCTCGAGAAGTCGATGCCGTAACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-840s1c1
Sequence:CCGGCCCACCTTCCTGCGCATCAAACTCGAGTTTGATGCGCAGGAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-626s1c1
Sequence:CCGGGCGCCTCATGAACCTGCATAACTCGAGTTATGCAGGTTCATGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058238.1-207s1c1
Sequence:CCGGTGCAACAAGATTCCTGGCCTACTCGAGTAGGCCAGGAATCTTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-261s1c1
Sequence:CCGGCCCGATGCCATCATTGTGATTCTCGAGAATCACAATGATGGCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058238.2-1149s21c1
Sequence:CCGGAGCTATCAGAAGCCCATGGAGCTCGAGCTCCATGGGCTTCTGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058238.2-1753s21c1
Sequence:CCGGCTGTATCCCAGAGAGCAAAGTCTCGAGACTTTGCTCTCTGGGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058238.2-1337s21c1
Sequence:CCGGGTGGCAGTGCAACTGCAAATTCTCGAGAATTTGCAGTTGCACTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058238.2-1184s21c1
Sequence:CCGGCATTGAGAAGTCGCCCAACTACTCGAGTAGTTGGGCGACTTCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058238
VALIDATED
WNT7B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 7B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-560s1c1
Sequence:CCGGCGTGCGTTACGGCATCGACTTCTCGAGAAGTCGATGCCGTAACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-840s1c1
Sequence:CCGGCCCACCTTCCTGCGCATCAAACTCGAGTTTGATGCGCAGGAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-626s1c1
Sequence:CCGGGCGCCTCATGAACCTGCATAACTCGAGTTATGCAGGTTCATGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058238.1-207s1c1
Sequence:CCGGTGCAACAAGATTCCTGGCCTACTCGAGTAGGCCAGGAATCTTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-261s1c1
Sequence:CCGGCCCGATGCCATCATTGTGATTCTCGAGAATCACAATGATGGCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058238.2-1149s21c1
Sequence:CCGGAGCTATCAGAAGCCCATGGAGCTCGAGCTCCATGGGCTTCTGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058238.2-1753s21c1
Sequence:CCGGCTGTATCCCAGAGAGCAAAGTCTCGAGACTTTGCTCTCTGGGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058238.2-1337s21c1
Sequence:CCGGGTGGCAGTGCAACTGCAAATTCTCGAGAATTTGCAGTTGCACTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058238.2-1184s21c1
Sequence:CCGGCATTGAGAAGTCGCCCAACTACTCGAGTAGTTGGGCGACTTCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058238
VALIDATED
WNT7B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 7B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-560s1c1
Sequence:CCGGCGTGCGTTACGGCATCGACTTCTCGAGAAGTCGATGCCGTAACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-840s1c1
Sequence:CCGGCCCACCTTCCTGCGCATCAAACTCGAGTTTGATGCGCAGGAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-626s1c1
Sequence:CCGGGCGCCTCATGAACCTGCATAACTCGAGTTATGCAGGTTCATGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058238.1-207s1c1
Sequence:CCGGTGCAACAAGATTCCTGGCCTACTCGAGTAGGCCAGGAATCTTGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_058238.1-261s1c1
Sequence:CCGGCCCGATGCCATCATTGTGATTCTCGAGAATCACAATGATGGCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058238.2-1149s21c1
Sequence:CCGGAGCTATCAGAAGCCCATGGAGCTCGAGCTCCATGGGCTTCTGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058238.2-1753s21c1
Sequence:CCGGCTGTATCCCAGAGAGCAAAGTCTCGAGACTTTGCTCTCTGGGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058238.2-1337s21c1
Sequence:CCGGGTGGCAGTGCAACTGCAAATTCTCGAGAATTTGCAGTTGCACTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058238.2-1184s21c1
Sequence:CCGGCATTGAGAAGTCGCCCAACTACTCGAGTAGTTGGGCGACTTCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks