EMAIL THIS PAGE TO A FRIEND

WNT8A

wingless-type MMTV integration site family, member 8A

Synonyms: WNT8D
UniProtKB ID: Q9H1J5, Q96S51
Gene ID:
Human(7478) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family, and may be implicated in development of early embryos as well as germ cell tumors. It encodes a protein which shows 81% amino acid identity to the mouse Wnt8A protein. [provided by RefSeq, Jul 2008]
Mouse(20890) wingless-related MMTV integration site 8A
Rat(291678) wingless-type MMTV integration site family, member 8A
Zebrafish(30122) wingless-type MMTV integration site family, member 8a
chicken(396543) wingless-type MMTV integration site family, member 8A
dog(481525) wingless-type MMTV integration site family, member 8A
domestic cat(101089489) wingless-type MMTV integration site family, member 8A
Horse(100072609) wingless-type MMTV integration site family, member 8A
domestic guinea pig(100725534) wingless-type MMTV integration site family, member 8A
naked mole-rat(101711747) wingless-type MMTV integration site family, member 8A
cow(540199) wingless-type MMTV integration site family, member 8A
sheep(101108044) wingless-type MMTV integration site family, member 8A
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_058244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058244 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031933 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU013441 MISSION® esiRNA esiRNA targeting mouse Wnt8a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058244 Rosetta Predictions human pricing
NM_001106155 Rosetta Predictions rat pricing
NM_009290 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210109 predicted 765
2 SASI_Hs01_00210110 predicted 342
3 SASI_Hs01_00210111 predicted 960
4 SASI_Hs01_00210112 predicted 928
5 SASI_Hs01_00210113 predicted 919
6 SASI_Hs01_00210114 predicted 916
7 SASI_Hs01_00210115 predicted 614
8 SASI_Hs01_00210116 predicted 245
9 SASI_Hs01_00210117 predicted 754
10 SASI_Hs01_00210118 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216168 predicted 1392
2 SASI_Rn02_00216169 predicted 1312
3 SASI_Rn02_00216170 predicted 1375
4 SASI_Rn02_00216171 predicted 1318
5 SASI_Rn02_00216172 predicted 483
6 SASI_Rn02_00216173 predicted 1094
7 SASI_Rn02_00216174 predicted 1338
8 SASI_Rn02_00216175 predicted 383
9 SASI_Rn02_00216176 predicted 1193
10 SASI_Rn02_00216177 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315799 predicted 544
2 SASI_Mm02_00315800 predicted 771
3 SASI_Mm01_00049222 predicted 1138
4 SASI_Mm02_00315801 predicted 225
5 SASI_Mm01_00049225 predicted 1190
6 SASI_Mm01_00049226 predicted 1266
7 SASI_Mm02_00315802 predicted 1206
8 SASI_Mm02_00315803 predicted 278
9 SASI_Mm02_00315804 predicted 645
10 SASI_Mm02_00315805 predicted 635
11 SASI_Mm01_00049223 predicted 669
12 SASI_Mm01_00049224 predicted 1415
13 SASI_Mm01_00049227 predicted 729
14 SASI_Mm01_00049228 predicted 1381
15 SASI_Mm01_00049229 predicted 1372
16 SASI_Mm01_00049230 predicted 1228
17 SASI_Mm01_00049231 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009290
WNT8A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 8A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009290.2-471s21c1
Sequence:CCGGAGACTCTTCGTGGACAGTTTGCTCGAGCAAACTGTCCACGAAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009290.2-113s21c1
Sequence:CCGGAGTGAACAACTTCCTGATAACCTCGAGGTTATCAGGAAGTTGTTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009290.2-1421s21c1
Sequence:CCGGGAGCCTGGAAGAACCGTATTCCTCGAGGAATACGGTTCTTCCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009290.1-1371s1c1
Sequence:CCGGGCGCAGTTACTCTTGGACTTACTCGAGTAAGTCCAAGAGTAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-662s1c1
Sequence:CCGGGCAGATGGGAAATTACCTAAACTCGAGTTTAGGTAATTTCCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-299s1c1
Sequence:CCGGCACGAGAGAGACATCCTTCATCTCGAGATGAAGGATGTCTCTCTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-200s1c1
Sequence:CCGGGATTGGCATCGAAGAGTGTAACTCGAGTTACACTCTTCGATGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-994s1c1
Sequence:CCGGACTGCAACTTTCAGTGGTGTTCTCGAGAACACCACTGAAAGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009290
WNT8A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 8A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009290.2-471s21c1
Sequence:CCGGAGACTCTTCGTGGACAGTTTGCTCGAGCAAACTGTCCACGAAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009290.2-113s21c1
Sequence:CCGGAGTGAACAACTTCCTGATAACCTCGAGGTTATCAGGAAGTTGTTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009290.2-1421s21c1
Sequence:CCGGGAGCCTGGAAGAACCGTATTCCTCGAGGAATACGGTTCTTCCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009290.1-1371s1c1
Sequence:CCGGGCGCAGTTACTCTTGGACTTACTCGAGTAAGTCCAAGAGTAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-662s1c1
Sequence:CCGGGCAGATGGGAAATTACCTAAACTCGAGTTTAGGTAATTTCCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-299s1c1
Sequence:CCGGCACGAGAGAGACATCCTTCATCTCGAGATGAAGGATGTCTCTCTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-200s1c1
Sequence:CCGGGATTGGCATCGAAGAGTGTAACTCGAGTTACACTCTTCGATGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-994s1c1
Sequence:CCGGACTGCAACTTTCAGTGGTGTTCTCGAGAACACCACTGAAAGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009290
WNT8A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 8A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009290.2-471s21c1
Sequence:CCGGAGACTCTTCGTGGACAGTTTGCTCGAGCAAACTGTCCACGAAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009290.2-113s21c1
Sequence:CCGGAGTGAACAACTTCCTGATAACCTCGAGGTTATCAGGAAGTTGTTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009290.2-1421s21c1
Sequence:CCGGGAGCCTGGAAGAACCGTATTCCTCGAGGAATACGGTTCTTCCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009290.1-1371s1c1
Sequence:CCGGGCGCAGTTACTCTTGGACTTACTCGAGTAAGTCCAAGAGTAACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-662s1c1
Sequence:CCGGGCAGATGGGAAATTACCTAAACTCGAGTTTAGGTAATTTCCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-299s1c1
Sequence:CCGGCACGAGAGAGACATCCTTCATCTCGAGATGAAGGATGTCTCTCTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-200s1c1
Sequence:CCGGGATTGGCATCGAAGAGTGTAACTCGAGTTACACTCTTCGATGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009290.1-994s1c1
Sequence:CCGGACTGCAACTTTCAGTGGTGTTCTCGAGAACACCACTGAAAGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058244
WNT8A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 8A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-1046s21c1
Sequence:CCGGTAAGGGCAGTGCCTGATAATACTCGAGTATTATCAGGCACTGCCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058244.2-1213s21c1
Sequence:CCGGCCAAGATTCTACAGCATATTCCTCGAGGAATATGCTGTAGAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-790s21c1
Sequence:CCGGATTCCAGCCTGGGCATCTATGCTCGAGCATAGATGCCCAGGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-339s21c1
Sequence:CCGGTGTGGCTGTGATGGGTCAAACCTCGAGGTTTGACCCATCACAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-989s21c1
Sequence:CCGGGCATGTGGTGAGCAAGTATTACTCGAGTAATACTTGCTCACCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058244
WNT8A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 8A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-1046s21c1
Sequence:CCGGTAAGGGCAGTGCCTGATAATACTCGAGTATTATCAGGCACTGCCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058244.2-1213s21c1
Sequence:CCGGCCAAGATTCTACAGCATATTCCTCGAGGAATATGCTGTAGAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-790s21c1
Sequence:CCGGATTCCAGCCTGGGCATCTATGCTCGAGCATAGATGCCCAGGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-339s21c1
Sequence:CCGGTGTGGCTGTGATGGGTCAAACCTCGAGGTTTGACCCATCACAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-989s21c1
Sequence:CCGGGCATGTGGTGAGCAAGTATTACTCGAGTAATACTTGCTCACCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058244
WNT8A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 8A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-1046s21c1
Sequence:CCGGTAAGGGCAGTGCCTGATAATACTCGAGTATTATCAGGCACTGCCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058244.2-1213s21c1
Sequence:CCGGCCAAGATTCTACAGCATATTCCTCGAGGAATATGCTGTAGAATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-790s21c1
Sequence:CCGGATTCCAGCCTGGGCATCTATGCTCGAGCATAGATGCCCAGGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-339s21c1
Sequence:CCGGTGTGGCTGTGATGGGTCAAACCTCGAGGTTTGACCCATCACAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058244.2-989s21c1
Sequence:CCGGGCATGTGGTGAGCAAGTATTACTCGAGTAATACTTGCTCACCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031933
WNT8A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 8A
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000152151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031933.1-1443s1c1
Sequence:CCGGCCAATAATCCACCAGGATAAACTCGAGTTTATCCTGGTGGATTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031933.1-352s1c1
Sequence:CCGGGACTTCCTTCATACATGCTATCTCGAGATAGCATGTATGAAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031933
WNT8A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 8A
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000152151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031933.1-1443s1c1
Sequence:CCGGCCAATAATCCACCAGGATAAACTCGAGTTTATCCTGGTGGATTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031933.1-352s1c1
Sequence:CCGGGACTTCCTTCATACATGCTATCTCGAGATAGCATGTATGAAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031933
WNT8A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 8A
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000152151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031933.1-1443s1c1
Sequence:CCGGCCAATAATCCACCAGGATAAACTCGAGTTTATCCTGGTGGATTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031933.1-352s1c1
Sequence:CCGGGACTTCCTTCATACATGCTATCTCGAGATAGCATGTATGAAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks