EMAIL THIS PAGE TO A FRIEND

WNT8B

wingless-type MMTV integration site family, member 8B

UniProtKB ID: Q93098, O00771, Q5VX55, Q8WYK9
Gene ID:
Human(7479) Summary: The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 95%, 86% and 71% amino acid identity to the mouse, zebrafish and Xenopus Wnt8B proteins, respectively. The expression patterns of the human and mouse genes appear identical and are restricted to the developing brain. The chromosomal location of this gene to 10q24 suggests it as a candidate gene for partial epilepsy. [provided by RefSeq, Jul 2008]
Mouse(22423) wingless related MMTV integration site 8b
Rat(293990) wingless-type MMTV integration site family, member 8B
Zebrafish(30144) wingless-type MMTV integration site family, member 8b
domestic cat(101096357) wingless-type MMTV integration site family, member 8B
Horse(100070360) wingless-type MMTV integration site family, member 8B
dog(486841) wingless-type MMTV integration site family, member 8B
chicken(428953) wingless-type MMTV integration site family, member 8B
cow(538720) wingless-type MMTV integration site family, member 8B
sheep(101121814) wingless-type MMTV integration site family, member 8B
naked mole-rat(101715077) wingless-type MMTV integration site family, member 8B
domestic guinea pig(100724403) wingless-type MMTV integration site family, member 8B
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV33491 Anti-WNT8B antibody produced in rabbit IgG fraction of antiserum , mouse, guinea pig, zebrafish, human, horse, canine, rat, rabbit
western blot pricing
HPA036570 Anti-WNT8B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2900705 Anti-WNT8B antibody produced in rabbit affinity isolated antibody horse, mouse, monkey, rat, rabbit, dog, bovine, hamster, pig, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003393 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003393 Rosetta Predictions human pricing
NM_001106359 Rosetta Predictions rat pricing
NM_011720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335577 predicted 629
2 SASI_Hs01_00042662 predicted 200
3 SASI_Hs01_00042664 predicted 360
4 SASI_Hs02_00335578 predicted 585
5 SASI_Hs01_00042665 predicted 396
6 SASI_Hs02_00335579 predicted 1345
7 SASI_Hs01_00042668 predicted 1087
8 SASI_Hs01_00042667 predicted 1396
9 SASI_Hs02_00335580 predicted 1389
10 SASI_Hs02_00335581 predicted 1361
11 SASI_Hs01_00042663 predicted 237
12 SASI_Hs01_00042666 predicted 1370
13 SASI_Hs01_00042669 predicted 414
14 SASI_Hs01_00042670 predicted 394
15 SASI_Hs01_00042671 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218198 predicted 1127
2 SASI_Rn02_00218199 predicted 849
3 SASI_Rn02_00218200 predicted 637
4 SASI_Rn02_00218201 predicted 212
5 SASI_Rn02_00218202 predicted 548
6 SASI_Rn02_00218203 predicted 500
7 SASI_Rn02_00218204 predicted 635
8 SASI_Rn02_00218205 predicted 1133
9 SASI_Rn02_00218206 predicted 1122
10 SASI_Rn02_00218207 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119654 predicted 741
2 SASI_Mm01_00119655 predicted 374
3 SASI_Mm01_00119656 predicted 358
4 SASI_Mm01_00119657 predicted 288
5 SASI_Mm01_00119658 predicted 1163
6 SASI_Mm01_00119659 predicted 1305
7 SASI_Mm01_00119660 predicted 323
8 SASI_Mm01_00119661 predicted 733
9 SASI_Mm01_00119662 predicted 1333
10 SASI_Mm02_00321288 predicted 538
11 SASI_Mm01_00119653 predicted 1055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011720
WNT8B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 8B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-747s1c1
Sequence:CCGGGCGCACTTGAAGGAGAAGTATCTCGAGATACTTCTCCTTCAAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-162s1c1
Sequence:CCGGCTTCTAGTCACTTGTGTCCTTCTCGAGAAGGACACAAGTGACTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-1040s1c1
Sequence:CCGGCGAGACAGTGTCCAGCTGCAACTCGAGTTGCAGCTGGACACTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-549s1c1
Sequence:CCGGGAGGCAATTTCCAAGCAGTTTCTCGAGAAACTGCTTGGAAATTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-1166s1c1
Sequence:CCGGCAAACCGGGAAAGAACTCCTACTCGAGTAGGAGTTCTTTCCCGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011720.3-152s21c1
Sequence:CCGGTGTGCGTTCTTCTAGTCACTTCTCGAGAAGTGACTAGAAGAACGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011720
WNT8B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 8B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-747s1c1
Sequence:CCGGGCGCACTTGAAGGAGAAGTATCTCGAGATACTTCTCCTTCAAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-162s1c1
Sequence:CCGGCTTCTAGTCACTTGTGTCCTTCTCGAGAAGGACACAAGTGACTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-1040s1c1
Sequence:CCGGCGAGACAGTGTCCAGCTGCAACTCGAGTTGCAGCTGGACACTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-549s1c1
Sequence:CCGGGAGGCAATTTCCAAGCAGTTTCTCGAGAAACTGCTTGGAAATTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-1166s1c1
Sequence:CCGGCAAACCGGGAAAGAACTCCTACTCGAGTAGGAGTTCTTTCCCGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011720.3-152s21c1
Sequence:CCGGTGTGCGTTCTTCTAGTCACTTCTCGAGAAGTGACTAGAAGAACGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011720
WNT8B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 8B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-747s1c1
Sequence:CCGGGCGCACTTGAAGGAGAAGTATCTCGAGATACTTCTCCTTCAAGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-162s1c1
Sequence:CCGGCTTCTAGTCACTTGTGTCCTTCTCGAGAAGGACACAAGTGACTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-1040s1c1
Sequence:CCGGCGAGACAGTGTCCAGCTGCAACTCGAGTTGCAGCTGGACACTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-549s1c1
Sequence:CCGGGAGGCAATTTCCAAGCAGTTTCTCGAGAAACTGCTTGGAAATTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011720.1-1166s1c1
Sequence:CCGGCAAACCGGGAAAGAACTCCTACTCGAGTAGGAGTTCTTTCCCGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011720.3-152s21c1
Sequence:CCGGTGTGCGTTCTTCTAGTCACTTCTCGAGAAGTGACTAGAAGAACGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003393
WNT8B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 8B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-275s1c1
Sequence:CCGGCCCAGAGTGGTATTGAAGAATCTCGAGATTCTTCAATACCACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-656s1c1
Sequence:CCGGGCACCATGAAACGCACGTGTACTCGAGTACACGTGCGTTTCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-891s1c1
Sequence:CCGGCCCGGACTACTGCCTGGAGAACTCGAGTTCTCCAGGCAGTAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-243s1c1
Sequence:CCGGCCTGATTTACTCCAGCAGTGTCTCGAGACACTGCTGGAGTAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003393.3-356s21c1
Sequence:CCGGCCAATCGGGAGACAGCATTTGCTCGAGCAAATGCTGTCTCCCGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003393.3-1283s21c1
Sequence:CCGGAGAGGGAGAGACTGCAATTTCCTCGAGGAAATTGCAGTCTCTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003393.3-533s21c1
Sequence:CCGGAGGCGATTTCCAAGCAGTTTGCTCGAGCAAACTGCTTGGAAATCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003393.3-176s21c1
Sequence:CCGGACAGCTGGTCGGTGAACAATTCTCGAGAATTGTTCACCGACCAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003393.3-1529s21c1
Sequence:CCGGAGGACCCAGGTAAAGTCAAAGCTCGAGCTTTGACTTTACCTGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003393
WNT8B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 8B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-275s1c1
Sequence:CCGGCCCAGAGTGGTATTGAAGAATCTCGAGATTCTTCAATACCACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-656s1c1
Sequence:CCGGGCACCATGAAACGCACGTGTACTCGAGTACACGTGCGTTTCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-891s1c1
Sequence:CCGGCCCGGACTACTGCCTGGAGAACTCGAGTTCTCCAGGCAGTAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-243s1c1
Sequence:CCGGCCTGATTTACTCCAGCAGTGTCTCGAGACACTGCTGGAGTAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003393.3-356s21c1
Sequence:CCGGCCAATCGGGAGACAGCATTTGCTCGAGCAAATGCTGTCTCCCGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003393.3-1283s21c1
Sequence:CCGGAGAGGGAGAGACTGCAATTTCCTCGAGGAAATTGCAGTCTCTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003393.3-533s21c1
Sequence:CCGGAGGCGATTTCCAAGCAGTTTGCTCGAGCAAACTGCTTGGAAATCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003393.3-176s21c1
Sequence:CCGGACAGCTGGTCGGTGAACAATTCTCGAGAATTGTTCACCGACCAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003393.3-1529s21c1
Sequence:CCGGAGGACCCAGGTAAAGTCAAAGCTCGAGCTTTGACTTTACCTGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003393
WNT8B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 8B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-275s1c1
Sequence:CCGGCCCAGAGTGGTATTGAAGAATCTCGAGATTCTTCAATACCACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-656s1c1
Sequence:CCGGGCACCATGAAACGCACGTGTACTCGAGTACACGTGCGTTTCATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-891s1c1
Sequence:CCGGCCCGGACTACTGCCTGGAGAACTCGAGTTCTCCAGGCAGTAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003393.2-243s1c1
Sequence:CCGGCCTGATTTACTCCAGCAGTGTCTCGAGACACTGCTGGAGTAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003393.3-356s21c1
Sequence:CCGGCCAATCGGGAGACAGCATTTGCTCGAGCAAATGCTGTCTCCCGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003393.3-1283s21c1
Sequence:CCGGAGAGGGAGAGACTGCAATTTCCTCGAGGAAATTGCAGTCTCTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003393.3-533s21c1
Sequence:CCGGAGGCGATTTCCAAGCAGTTTGCTCGAGCAAACTGCTTGGAAATCGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003393.3-176s21c1
Sequence:CCGGACAGCTGGTCGGTGAACAATTCTCGAGAATTGTTCACCGACCAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003393.3-1529s21c1
Sequence:CCGGAGGACCCAGGTAAAGTCAAAGCTCGAGCTTTGACTTTACCTGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks