EMAIL THIS PAGE TO A FRIEND

WNT9A

wingless-type MMTV integration site family, member 9A

Synonyms: WNT14
UniProtKB ID: O14904, A6NLW2, Q2M2J3, Q5VWU0, Q96S50
Gene ID:
Human(7483) Summary: The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is expressed in gastric cancer cell lines. The protein encoded by this gene shows 75% amino acid identity to chicken Wnt14, which has been shown to play a central role in initiating synovial joint formation in the chick limb. This gene is clustered with another family member, WNT3A, in the chromosome 1q42 region. [provided by RefSeq, Jul 2008]
Mouse(216795) wingless-type MMTV integration site 9A
Rat(287357) wingless-type MMTV integration site family, member 9A
domestic guinea pig(100726329) wingless-type MMTV integration site family, member 9A
naked mole-rat(101715480) wingless-type MMTV integration site family, member 9A
Domestic Rabbit(100352227) wingless-type MMTV integration site family, member 9A
cow(511308) wingless-type MMTV integration site family, member 9A
sheep(101102060) wingless-type MMTV integration site family, member 9A
Zebrafish(751644) wingless-type MMTV integration site family, member 9A
Horse(100061110) wingless-type MMTV integration site family, member 9A
domestic cat(101080860) wingless-type MMTV integration site family, member 9A
dog(482209) wingless-type MMTV integration site family, member 9A
chicken(395829) wingless-type MMTV integration site family, member 9A
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003395 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060001 MISSION® esiRNA esiRNA targeting mouse Wnt9a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003395 Rosetta Predictions human pricing
NM_001105783 Rosetta Predictions rat pricing
NM_139298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145383 predicted 1230
2 SASI_Hs01_00145385 predicted 1356
3 SASI_Hs01_00145386 predicted 1222
4 SASI_Hs02_00335583 predicted 700
5 SASI_Hs01_00145387 predicted 1344
6 SASI_Hs01_00145388 predicted 732
7 SASI_Hs01_00145389 predicted 738
8 SASI_Hs02_00335584 predicted 293
9 SASI_Hs01_00145390 predicted 1139
10 SASI_Hs01_00145391 predicted 547
11 SASI_Hs01_00145384 predicted 595
12 SASI_Hs01_00145392 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212486 predicted 1034
2 SASI_Rn02_00212487 predicted 1159
3 SASI_Rn02_00212488 predicted 1165
4 SASI_Rn02_00212489 predicted 665
5 SASI_Rn02_00212490 predicted 434
6 SASI_Rn02_00212491 predicted 720
7 SASI_Rn02_00212492 predicted 1093
8 SASI_Rn02_00212493 predicted 192
9 SASI_Rn02_00212494 predicted 355
10 SASI_Rn02_00212495 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132399 predicted 1099
2 SASI_Mm01_00132400 predicted 989
3 SASI_Mm01_00132401 predicted 1259
4 SASI_Mm01_00132402 predicted 1270
5 SASI_Mm01_00132404 predicted 391
6 SASI_Mm01_00132405 predicted 1233
7 SASI_Mm01_00132406 predicted 666
8 SASI_Mm01_00132407 predicted 1106
9 SASI_Mm01_00132408 predicted 317
10 SASI_Mm02_00339985 predicted 387
11 SASI_Mm01_00132403 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003395
WNT9A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 9A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003395.2-692s21c1
Sequence:CCGGGTGGGTGTGAAGGTGATCAAGCTCGAGCTTGATCACCTTCACACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003395.2-377s21c1
Sequence:CCGGTTCCGCTTTGAGCGCTGGAACCTCGAGGTTCCAGCGCTCAAAGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003395.2-639s21c1
Sequence:CCGGGCAGACGGTCAAGCAAGGATCCTCGAGGATCCTTGCTTGACCGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-535s1c1
Sequence:CCGGGCAGCAAGTTCGTCAAGGAATCTCGAGATTCCTTGACGAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-956s1c1
Sequence:CCGGTGAGAAGAACTGCGAGAGCATCTCGAGATGCTCTCGCAGTTCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-512s1c1
Sequence:CCGGCTGCGGAGACAACCTTAAGTACTCGAGTACTTAAGGTTGTCTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-884s1c1
Sequence:CCGGCCTGGATGACTCGCCTAGCTTCTCGAGAAGCTAGGCGAGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-746s1c1
Sequence:CCGGCAAGTATGAGACGGCACTCAACTCGAGTTGAGTGCCGTCTCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003395
WNT9A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 9A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003395.2-692s21c1
Sequence:CCGGGTGGGTGTGAAGGTGATCAAGCTCGAGCTTGATCACCTTCACACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003395.2-377s21c1
Sequence:CCGGTTCCGCTTTGAGCGCTGGAACCTCGAGGTTCCAGCGCTCAAAGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003395.2-639s21c1
Sequence:CCGGGCAGACGGTCAAGCAAGGATCCTCGAGGATCCTTGCTTGACCGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-535s1c1
Sequence:CCGGGCAGCAAGTTCGTCAAGGAATCTCGAGATTCCTTGACGAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-956s1c1
Sequence:CCGGTGAGAAGAACTGCGAGAGCATCTCGAGATGCTCTCGCAGTTCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-512s1c1
Sequence:CCGGCTGCGGAGACAACCTTAAGTACTCGAGTACTTAAGGTTGTCTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-884s1c1
Sequence:CCGGCCTGGATGACTCGCCTAGCTTCTCGAGAAGCTAGGCGAGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-746s1c1
Sequence:CCGGCAAGTATGAGACGGCACTCAACTCGAGTTGAGTGCCGTCTCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003395
WNT9A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 9A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003395.2-692s21c1
Sequence:CCGGGTGGGTGTGAAGGTGATCAAGCTCGAGCTTGATCACCTTCACACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003395.2-377s21c1
Sequence:CCGGTTCCGCTTTGAGCGCTGGAACCTCGAGGTTCCAGCGCTCAAAGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003395.2-639s21c1
Sequence:CCGGGCAGACGGTCAAGCAAGGATCCTCGAGGATCCTTGCTTGACCGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-535s1c1
Sequence:CCGGGCAGCAAGTTCGTCAAGGAATCTCGAGATTCCTTGACGAACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-956s1c1
Sequence:CCGGTGAGAAGAACTGCGAGAGCATCTCGAGATGCTCTCGCAGTTCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-512s1c1
Sequence:CCGGCTGCGGAGACAACCTTAAGTACTCGAGTACTTAAGGTTGTCTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-884s1c1
Sequence:CCGGCCTGGATGACTCGCCTAGCTTCTCGAGAAGCTAGGCGAGTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003395.1-746s1c1
Sequence:CCGGCAAGTATGAGACGGCACTCAACTCGAGTTGAGTGCCGTCTCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139298
WNT9A MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 9A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-953s1c1
Sequence:CCGGGAGAAGAACTGTGAGAGTATTCTCGAGAATACTCTCACAGTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-529s1c1
Sequence:CCGGCAGCAGCAAGTTTGTCAAGGACTCGAGTCCTTGACAAACTTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-358s1c1
Sequence:CCGGAGGCTTCAAGGAGACTGCTTTCTCGAGAAAGCAGTCTCCTTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-375s1c1
Sequence:CCGGCTTTCCTCTACGCCATCTCTTCTCGAGAAGAGATGGCGTAGAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-641s1c1
Sequence:CCGGGAAACCACTTGCAAATGCCATCTCGAGATGGCATTTGCAAGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139298
WNT9A MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 9A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-953s1c1
Sequence:CCGGGAGAAGAACTGTGAGAGTATTCTCGAGAATACTCTCACAGTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-529s1c1
Sequence:CCGGCAGCAGCAAGTTTGTCAAGGACTCGAGTCCTTGACAAACTTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-358s1c1
Sequence:CCGGAGGCTTCAAGGAGACTGCTTTCTCGAGAAAGCAGTCTCCTTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-375s1c1
Sequence:CCGGCTTTCCTCTACGCCATCTCTTCTCGAGAAGAGATGGCGTAGAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-641s1c1
Sequence:CCGGGAAACCACTTGCAAATGCCATCTCGAGATGGCATTTGCAAGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139298
WNT9A MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 9A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-953s1c1
Sequence:CCGGGAGAAGAACTGTGAGAGTATTCTCGAGAATACTCTCACAGTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-529s1c1
Sequence:CCGGCAGCAGCAAGTTTGTCAAGGACTCGAGTCCTTGACAAACTTGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-358s1c1
Sequence:CCGGAGGCTTCAAGGAGACTGCTTTCTCGAGAAAGCAGTCTCCTTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-375s1c1
Sequence:CCGGCTTTCCTCTACGCCATCTCTTCTCGAGAAGAGATGGCGTAGAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139298.1-641s1c1
Sequence:CCGGGAAACCACTTGCAAATGCCATCTCGAGATGGCATTTGCAAGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks