EMAIL THIS PAGE TO A FRIEND

WNT9B

wingless-type MMTV integration site family, member 9B

Synonyms: WNT14B WNT15
UniProtKB ID: O14905, Q6UXT4, Q96Q09
Gene ID:
Human(7484) Summary: The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. Study of its expression in the teratocarcinoma cell line NT2 suggests that it may be implicated in the early process of neuronal differentiation of NT2 cells induced by retinoic acid. This gene is clustered with WNT3, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]
Mouse(22412) wingless-type MMTV integration site 9B
Rat(303586) wingless-type MMTV integration site family, member 9B
Zebrafish(565677) wingless-type MMTV integration site family, member 9B
chicken(771092) wingless-type MMTV integration site family, member 9B
Horse(100063730) wingless-type MMTV integration site family, member 9B
domestic cat(101080844) wingless-type MMTV integration site family, member 9B
dog(490919) wingless-type MMTV integration site family, member 9B
cow(541243) wingless-type MMTV integration site family, member 9B
sheep(101120506) wingless-type MMTV integration site family, member 9B
domestic guinea pig(100729157) wingless-type MMTV integration site family, member 9B
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003396 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003396 Rosetta Predictions human pricing
NM_001107055 Rosetta Predictions rat pricing
NM_011719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177070 predicted 375
2 SASI_Hs01_00177071 predicted 758
3 SASI_Hs02_00335585 predicted 317
4 SASI_Hs01_00177073 predicted 646
5 SASI_Hs01_00177074 predicted 1083
6 SASI_Hs02_00335586 predicted 914
7 SASI_Hs01_00177075 predicted 544
8 SASI_Hs01_00177076 predicted 525
9 SASI_Hs01_00177077 predicted 1090
10 SASI_Hs01_00177078 predicted 385
11 SASI_Hs01_00177072 predicted 627
12 SASI_Hs01_00177079 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225046 predicted 780
2 SASI_Rn02_00225047 predicted 751
3 SASI_Rn02_00225048 predicted 400
4 SASI_Rn02_00225049 predicted 1575
5 SASI_Rn02_00225050 predicted 1623
6 SASI_Rn02_00225051 predicted 1199
7 SASI_Rn02_00225052 predicted 938
8 SASI_Rn02_00225053 predicted 1491
9 SASI_Rn02_00225054 predicted 1070
10 SASI_Rn02_00225055 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147970 predicted 1398
2 SASI_Mm01_00147971 predicted 1553
3 SASI_Mm01_00147972 predicted 1492
4 SASI_Mm01_00147973 predicted 774
5 SASI_Mm01_00147974 predicted 1404
6 SASI_Mm01_00147975 predicted 384
7 SASI_Mm01_00147976 predicted 1133
8 SASI_Mm02_00321287 predicted 961
9 SASI_Mm01_00147978 predicted 1106
10 SASI_Mm01_00147979 predicted 1285
11 SASI_Mm01_00147977 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011719
WNT9B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 9B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-542s1c1
Sequence:CCGGGTGTGGTGACAATCTGAAGTACTCGAGTACTTCAGATTGTCACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-1112s1c1
Sequence:CCGGCGTGTATACCTGCAAGCGCTACTCGAGTAGCGCTTGCAGGTATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-907s1c1
Sequence:CCGGACATGGAAGATTCTCCCAGCTCTCGAGAGCTGGGAGAATCTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-765s1c1
Sequence:CCGGCAGGTGCTGAAGCTACGCTATCTCGAGATAGCGTAGCTTCAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-215s1c1
Sequence:CCGGGAAGCAGTGTGACCTACTGAACTCGAGTTCAGTAGGTCACACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011719
WNT9B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 9B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-542s1c1
Sequence:CCGGGTGTGGTGACAATCTGAAGTACTCGAGTACTTCAGATTGTCACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-1112s1c1
Sequence:CCGGCGTGTATACCTGCAAGCGCTACTCGAGTAGCGCTTGCAGGTATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-907s1c1
Sequence:CCGGACATGGAAGATTCTCCCAGCTCTCGAGAGCTGGGAGAATCTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-765s1c1
Sequence:CCGGCAGGTGCTGAAGCTACGCTATCTCGAGATAGCGTAGCTTCAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-215s1c1
Sequence:CCGGGAAGCAGTGTGACCTACTGAACTCGAGTTCAGTAGGTCACACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011719
WNT9B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 9B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-542s1c1
Sequence:CCGGGTGTGGTGACAATCTGAAGTACTCGAGTACTTCAGATTGTCACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-1112s1c1
Sequence:CCGGCGTGTATACCTGCAAGCGCTACTCGAGTAGCGCTTGCAGGTATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-907s1c1
Sequence:CCGGACATGGAAGATTCTCCCAGCTCTCGAGAGCTGGGAGAATCTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-765s1c1
Sequence:CCGGCAGGTGCTGAAGCTACGCTATCTCGAGATAGCGTAGCTTCAGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011719.2-215s1c1
Sequence:CCGGGAAGCAGTGTGACCTACTGAACTCGAGTTCAGTAGGTCACACTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003396
WNT9B MISSION shRNA Bacterial Glycerol Stock
wingless-type MMTV integration site family, member 9B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-533s1c1
Sequence:CCGGCTCAAGTACAGCACCAAGTTTCTCGAGAAACTTGGTGCTGTACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-369s1c1
Sequence:CCGGGAGGCTTCAAAGAGACAGCTTCTCGAGAAGCTGTCTCTTTGAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-625s1c1
Sequence:CCGGCGTGGGCATCAAGGCTGTGAACTCGAGTTCACAGCCTTGATGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-757s1c1
Sequence:CCGGGCGCTATGACTCGGCTGTCAACTCGAGTTGACAGCCGAGTCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-543s1c1
Sequence:CCGGGCACCAAGTTTCTGAGCAACTCTCGAGAGTTGCTCAGAAACTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003396.1-1085s21c1
Sequence:CCGGGAGCTTGTGTACACCTGCAAGCTCGAGCTTGCAGGTGTACACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003396.1-295s21c1
Sequence:CCGGGCTTGAGTGCCAGTTTCAGTTCTCGAGAACTGAAACTGGCACTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003396.1-1197s21c1
Sequence:CCGGGTCATCACATGCATGCATAAACTCGAGTTTATGCATGCATGTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003396
WNT9B MISSION shRNA shRNA Plasmid DNA
wingless-type MMTV integration site family, member 9B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-533s1c1
Sequence:CCGGCTCAAGTACAGCACCAAGTTTCTCGAGAAACTTGGTGCTGTACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-369s1c1
Sequence:CCGGGAGGCTTCAAAGAGACAGCTTCTCGAGAAGCTGTCTCTTTGAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-625s1c1
Sequence:CCGGCGTGGGCATCAAGGCTGTGAACTCGAGTTCACAGCCTTGATGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-757s1c1
Sequence:CCGGGCGCTATGACTCGGCTGTCAACTCGAGTTGACAGCCGAGTCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-543s1c1
Sequence:CCGGGCACCAAGTTTCTGAGCAACTCTCGAGAGTTGCTCAGAAACTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003396.1-1085s21c1
Sequence:CCGGGAGCTTGTGTACACCTGCAAGCTCGAGCTTGCAGGTGTACACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003396.1-295s21c1
Sequence:CCGGGCTTGAGTGCCAGTTTCAGTTCTCGAGAACTGAAACTGGCACTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003396.1-1197s21c1
Sequence:CCGGGTCATCACATGCATGCATAAACTCGAGTTTATGCATGCATGTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003396
WNT9B MISSION shRNA Lentiviral Transduction Particles
wingless-type MMTV integration site family, member 9B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-533s1c1
Sequence:CCGGCTCAAGTACAGCACCAAGTTTCTCGAGAAACTTGGTGCTGTACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-369s1c1
Sequence:CCGGGAGGCTTCAAAGAGACAGCTTCTCGAGAAGCTGTCTCTTTGAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-625s1c1
Sequence:CCGGCGTGGGCATCAAGGCTGTGAACTCGAGTTCACAGCCTTGATGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-757s1c1
Sequence:CCGGGCGCTATGACTCGGCTGTCAACTCGAGTTGACAGCCGAGTCATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003396.1-543s1c1
Sequence:CCGGGCACCAAGTTTCTGAGCAACTCTCGAGAGTTGCTCAGAAACTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003396.1-1085s21c1
Sequence:CCGGGAGCTTGTGTACACCTGCAAGCTCGAGCTTGCAGGTGTACACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003396.1-295s21c1
Sequence:CCGGGCTTGAGTGCCAGTTTCAGTTCTCGAGAACTGAAACTGGCACTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003396.1-1197s21c1
Sequence:CCGGGTCATCACATGCATGCATAAACTCGAGTTTATGCATGCATGTGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks