EMAIL THIS PAGE TO A FRIEND

WRAP53

WD repeat containing, antisense to TP53

Synonyms: DKCB3 TCAB1 WDR79
UniProtKB ID: Q9BUR4, B3KPR9, D3DTQ4, Q08ET9, Q9NW09
Gene ID:
Human(55135) Summary: This gene encodes an essential component of the telomerase holoenzyme complex, a ribonucleoprotein complex required for telomere synthesis. This protein is enriched in Cajal bodies, nuclear sites of RNP processing that are important for telomerase function. It interacts with dyskerin, TERT and TERC, other components of active telomerase, and with small Cajal body RNAs (scaRNAs), which are involved in modifying splicing RNAs. This mRNA also functions as a p53 antisense transcript, that regulates endogenous p53 mRNA levels and further induction of p53 protein by targeting the 5' untranslated region of p53 mRNA. Alternatively spliced transcript variants which differ only in the 5' UTR have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(216853) WD repeat containing, antisense to Trp53
Rat(287432) WD repeat containing, antisense to TP53
Zebrafish(321796) WD repeat containing, antisense to TP53
domestic cat(101099509) WD repeat containing, antisense to TP53
dog(607892) WD repeat containing, antisense to TP53
cow(509631) WD repeat containing, antisense to TP53
sheep(101103738) WD repeat containing, antisense to TP53
domestic guinea pig(100733673) WD repeat containing, antisense to TP53
Domestic Rabbit(100343593) WD repeat containing, antisense to TP53
naked mole-rat(101702587) WD repeat containing, antisense to TP53
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018081 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018081 Rosetta Predictions human pricing
NM_001007610 Rosetta Predictions rat pricing
NM_144824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351238 predicted 587
2 SASI_Hs01_00161446 predicted 1214
3 SASI_Hs02_00351239 predicted 811
4 SASI_Hs01_00161448 predicted 1414
5 SASI_Hs01_00161449 predicted 1404
6 SASI_Hs02_00351240 predicted 708
7 SASI_Hs02_00351241 predicted 638
8 SASI_Hs02_00351242 predicted 702
9 SASI_Hs02_00351243 predicted 592
10 SASI_Hs01_00161450 predicted 1297
11 SASI_Hs01_00161445 predicted 1406
12 SASI_Hs01_00161447 predicted 923
13 SASI_Hs01_00161451 predicted 1002
14 SASI_Hs01_00161452 predicted 1565
15 SASI_Hs01_00161453 predicted 1396
16 SASI_Hs01_00161454 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078789 predicted 1320
2 SASI_Rn01_00078791 predicted 371
3 SASI_Rn01_00078793 predicted 1204
4 SASI_Rn01_00078794 predicted 655
5 SASI_Rn01_00078795 predicted 1013
6 SASI_Rn01_00078796 predicted 1073
7 SASI_Rn01_00078797 predicted 835
8 SASI_Rn01_00078798 predicted 894
9 SASI_Rn02_00198696 predicted 589
10 SASI_Rn02_00198697 predicted 1061
11 SASI_Rn01_00078790 predicted 1249
12 SASI_Rn01_00078792 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166054 predicted 1454
2 SASI_Mm01_00166055 predicted 1342
3 SASI_Mm01_00166056 predicted 1543
4 SASI_Mm01_00166057 predicted 1328
5 SASI_Mm02_00340198 predicted 1379
6 SASI_Mm01_00166058 predicted 724
7 SASI_Mm01_00166059 predicted 773
8 SASI_Mm02_00340199 predicted 784
9 SASI_Mm01_00166061 predicted 1470
10 SASI_Mm01_00166062 predicted 986
11 SASI_Mm01_00166060 predicted 488
12 SASI_Mm01_00166063 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018081
VALIDATED
WRAP53 MISSION shRNA Bacterial Glycerol Stock
WD repeat containing, antisense to TP53
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018081.2-842s21c1
Sequence:CCGGGTTCCTGCATCTTGACCAATACTCGAGTATTGGTCAAGATGCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018081.2-867s21c1
Sequence:CCGGTGATAACATCTTGCGAATTTACTCGAGTAAATTCGCAAGATGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018081.2-795s21c1
Sequence:CCGGCACCCAACCTGAGAACTTCTTCTCGAGAAGAAGTTCTCAGGTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018081.2-978s21c1
Sequence:CCGGCTATGATTACTGCTGGTATTCCTCGAGGAATACCAGCAGTAATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018081.x-630s1c1
Sequence:CCGGTGCCTCGATTTCTCAGTGGTTCTCGAGAACCACTGAGAAATCGAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-935s1c1
Sequence:CCGGCATATCTGGGACGCATTCACTCTCGAGAGTGAATGCGTCCCAGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-714s1c1
Sequence:CCGGGTTCCTGCATCTTGACCAATACTCGAGTATTGGTCAAGATGCAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-1408s1c1
Sequence:CCGGCACCAATCAGCGCATCTACTTCTCGAGAAGTAGATGCGCTGATTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-667s1c1
Sequence:CCGGCACCCAACCTGAGAACTTCTTCTCGAGAAGAAGTTCTCAGGTTGGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018081
VALIDATED
WRAP53 MISSION shRNA shRNA Plasmid DNA
WD repeat containing, antisense to TP53
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018081.2-842s21c1
Sequence:CCGGGTTCCTGCATCTTGACCAATACTCGAGTATTGGTCAAGATGCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018081.2-867s21c1
Sequence:CCGGTGATAACATCTTGCGAATTTACTCGAGTAAATTCGCAAGATGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018081.2-795s21c1
Sequence:CCGGCACCCAACCTGAGAACTTCTTCTCGAGAAGAAGTTCTCAGGTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018081.2-978s21c1
Sequence:CCGGCTATGATTACTGCTGGTATTCCTCGAGGAATACCAGCAGTAATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018081.x-630s1c1
Sequence:CCGGTGCCTCGATTTCTCAGTGGTTCTCGAGAACCACTGAGAAATCGAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-935s1c1
Sequence:CCGGCATATCTGGGACGCATTCACTCTCGAGAGTGAATGCGTCCCAGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-714s1c1
Sequence:CCGGGTTCCTGCATCTTGACCAATACTCGAGTATTGGTCAAGATGCAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-1408s1c1
Sequence:CCGGCACCAATCAGCGCATCTACTTCTCGAGAAGTAGATGCGCTGATTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-667s1c1
Sequence:CCGGCACCCAACCTGAGAACTTCTTCTCGAGAAGAAGTTCTCAGGTTGGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018081
VALIDATED
WRAP53 MISSION shRNA Lentiviral Transduction Particles
WD repeat containing, antisense to TP53
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018081.2-842s21c1
Sequence:CCGGGTTCCTGCATCTTGACCAATACTCGAGTATTGGTCAAGATGCAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018081.2-867s21c1
Sequence:CCGGTGATAACATCTTGCGAATTTACTCGAGTAAATTCGCAAGATGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018081.2-795s21c1
Sequence:CCGGCACCCAACCTGAGAACTTCTTCTCGAGAAGAAGTTCTCAGGTTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018081.2-978s21c1
Sequence:CCGGCTATGATTACTGCTGGTATTCCTCGAGGAATACCAGCAGTAATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018081.x-630s1c1
Sequence:CCGGTGCCTCGATTTCTCAGTGGTTCTCGAGAACCACTGAGAAATCGAGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-935s1c1
Sequence:CCGGCATATCTGGGACGCATTCACTCTCGAGAGTGAATGCGTCCCAGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-714s1c1
Sequence:CCGGGTTCCTGCATCTTGACCAATACTCGAGTATTGGTCAAGATGCAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-1408s1c1
Sequence:CCGGCACCAATCAGCGCATCTACTTCTCGAGAAGTAGATGCGCTGATTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018081.x-667s1c1
Sequence:CCGGCACCCAACCTGAGAACTTCTTCTCGAGAAGAAGTTCTCAGGTTGGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144824
VALIDATED
WRAP53 MISSION shRNA Bacterial Glycerol Stock
WD repeat containing, antisense to TP53
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144824.2-902s1c1
Sequence:CCGGCTATGATTACTGCTGGTATTCCTCGAGGAATACCAGCAGTAATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144824.2-792s1c1
Sequence:CCGGGATAATGTCCTTCGGATTTACCTCGAGGTAAATCCGAAGGACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-791s21c1
Sequence:CCGGTGATAATGTCCTTCGGATTTACTCGAGTAAATCCGAAGGACATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-531s21c1
Sequence:CCGGGAGGAGCAAGATGTTTCTGAACTCGAGTTCAGAAACATCTTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-1457s21c1
Sequence:CCGGGACCACTAATCAGCGCATCTACTCGAGTAGATGCGCTGATTAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-543s21c1
Sequence:CCGGGTTTCTGAACATGCGAGTCTTCTCGAGAAGACTCGCATGTTCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-480s21c1
Sequence:CCGGGTACCTCTGGAAGTAGAATTTCTCGAGAAATTCTACTTCCAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-1457s1c1
Sequence:CCGGGACCACTAATCAGCGCATCTACTCGAGTAGATGCGCTGATTAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144824.1-731s1c1
Sequence:CCGGGAACTTCTTGAAAGGTTGCAACTCGAGTTGCAACCTTTCAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-531s1c1
Sequence:CCGGGAGGAGCAAGATGTTTCTGAACTCGAGTTCAGAAACATCTTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144824.1-822s1c1
Sequence:CCGGCCAGAATTGTACAGTGAACAACTCGAGTTGTTCACTGTACAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-983s1c1
Sequence:CCGGGATTCACATCTGGGATGCATTCTCGAGAATGCATCCCAGATGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-543s1c1
Sequence:CCGGGTTTCTGAACATGCGAGTCTTCTCGAGAAGACTCGCATGTTCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144824
VALIDATED
WRAP53 MISSION shRNA shRNA Plasmid DNA
WD repeat containing, antisense to TP53
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144824.2-902s1c1
Sequence:CCGGCTATGATTACTGCTGGTATTCCTCGAGGAATACCAGCAGTAATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144824.2-792s1c1
Sequence:CCGGGATAATGTCCTTCGGATTTACCTCGAGGTAAATCCGAAGGACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-791s21c1
Sequence:CCGGTGATAATGTCCTTCGGATTTACTCGAGTAAATCCGAAGGACATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-531s21c1
Sequence:CCGGGAGGAGCAAGATGTTTCTGAACTCGAGTTCAGAAACATCTTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-1457s21c1
Sequence:CCGGGACCACTAATCAGCGCATCTACTCGAGTAGATGCGCTGATTAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-543s21c1
Sequence:CCGGGTTTCTGAACATGCGAGTCTTCTCGAGAAGACTCGCATGTTCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-480s21c1
Sequence:CCGGGTACCTCTGGAAGTAGAATTTCTCGAGAAATTCTACTTCCAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-1457s1c1
Sequence:CCGGGACCACTAATCAGCGCATCTACTCGAGTAGATGCGCTGATTAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144824.1-731s1c1
Sequence:CCGGGAACTTCTTGAAAGGTTGCAACTCGAGTTGCAACCTTTCAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-531s1c1
Sequence:CCGGGAGGAGCAAGATGTTTCTGAACTCGAGTTCAGAAACATCTTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144824.1-822s1c1
Sequence:CCGGCCAGAATTGTACAGTGAACAACTCGAGTTGTTCACTGTACAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-983s1c1
Sequence:CCGGGATTCACATCTGGGATGCATTCTCGAGAATGCATCCCAGATGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-543s1c1
Sequence:CCGGGTTTCTGAACATGCGAGTCTTCTCGAGAAGACTCGCATGTTCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144824
VALIDATED
WRAP53 MISSION shRNA Lentiviral Transduction Particles
WD repeat containing, antisense to TP53
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144824.2-902s1c1
Sequence:CCGGCTATGATTACTGCTGGTATTCCTCGAGGAATACCAGCAGTAATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144824.2-792s1c1
Sequence:CCGGGATAATGTCCTTCGGATTTACCTCGAGGTAAATCCGAAGGACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-791s21c1
Sequence:CCGGTGATAATGTCCTTCGGATTTACTCGAGTAAATCCGAAGGACATTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-531s21c1
Sequence:CCGGGAGGAGCAAGATGTTTCTGAACTCGAGTTCAGAAACATCTTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-1457s21c1
Sequence:CCGGGACCACTAATCAGCGCATCTACTCGAGTAGATGCGCTGATTAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-543s21c1
Sequence:CCGGGTTTCTGAACATGCGAGTCTTCTCGAGAAGACTCGCATGTTCAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144824.2-480s21c1
Sequence:CCGGGTACCTCTGGAAGTAGAATTTCTCGAGAAATTCTACTTCCAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-1457s1c1
Sequence:CCGGGACCACTAATCAGCGCATCTACTCGAGTAGATGCGCTGATTAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144824.1-731s1c1
Sequence:CCGGGAACTTCTTGAAAGGTTGCAACTCGAGTTGCAACCTTTCAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-531s1c1
Sequence:CCGGGAGGAGCAAGATGTTTCTGAACTCGAGTTCAGAAACATCTTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144824.1-822s1c1
Sequence:CCGGCCAGAATTGTACAGTGAACAACTCGAGTTGTTCACTGTACAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-983s1c1
Sequence:CCGGGATTCACATCTGGGATGCATTCTCGAGAATGCATCCCAGATGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144824.1-543s1c1
Sequence:CCGGGTTTCTGAACATGCGAGTCTTCTCGAGAAGACTCGCATGTTCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks