EMAIL THIS PAGE TO A FRIEND

WRAP73

WD repeat containing, antisense to TP73

Synonyms: WDR8
UniProtKB ID: Q9P2S5, Q5T0D6, Q9BUH7, Q9NTK7, Q9NX56
Gene ID:
Human(49856) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Studies of the related mouse protein suggest that the encoded protein may play a role in the process of ossification. [provided by RefSeq, Mar 2009]
Mouse(59002) WD repeat containing, antisense to Trp73
Rat(366515) WD repeat containing, antisense to TP73
naked mole-rat(101717620) WD repeat containing, antisense to TP73
domestic guinea pig(100713938) WD repeat containing, antisense to TP73
cow(514669) WD repeat containing, antisense to TP73
sheep(101102658) WD repeat containing, antisense to TP73
Zebrafish(334381) WD repeat containing, antisense to TP73
chicken(419383) WD repeat containing, antisense to TP73
domestic cat(101087759) WD repeat containing, antisense to TP73
dog(479584) WD repeat containing, antisense to TP73
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017818 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017818 Rosetta Predictions human pricing
NM_001014262 Rosetta Predictions rat pricing
XM_001054638 Rosetta Predictions rat pricing
NM_021499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112064 predicted 659
2 SASI_Hs01_00112065 predicted 547
3 SASI_Hs01_00112066 predicted 243
4 SASI_Hs01_00112067 predicted 530
5 SASI_Hs01_00112068 predicted 469
6 SASI_Hs01_00112069 predicted 508
7 SASI_Hs01_00112070 predicted 1337
8 SASI_Hs01_00112071 predicted 1202
9 SASI_Hs01_00112072 predicted 412
10 SASI_Hs01_00112073 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076882 predicted 1274
2 SASI_Rn01_00076883 predicted 383
3 SASI_Rn01_00076884 predicted 825
4 SASI_Rn01_00076886 predicted 772
5 SASI_Rn01_00076887 predicted 617
6 SASI_Rn01_00076888 predicted 805
7 SASI_Rn01_00076889 predicted 1041
8 SASI_Rn01_00076890 predicted 1011
9 SASI_Rn01_00076891 predicted 234
10 SASI_Rn02_00201831 predicted 1058
11 SASI_Rn01_00076885 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276597 predicted 490
2 SASI_Rn02_00276598 predicted 475
3 SASI_Rn02_00276599 predicted 432
4 SASI_Rn02_00276600 predicted 435
5 SASI_Rn02_00276601 predicted 323
6 SASI_Rn02_00276602 predicted 409
7 SASI_Rn02_00276603 predicted 443
8 SASI_Rn02_00276604 predicted 399
9 SASI_Rn02_00276605 predicted 495
10 SASI_Rn02_00276606 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023267 predicted 1163
2 SASI_Mm01_00023268 predicted 276
3 SASI_Mm01_00023269 predicted 431
4 SASI_Mm02_00326201 predicted 659
5 SASI_Mm01_00023270 predicted 1101
6 SASI_Mm01_00023271 predicted 1087
7 SASI_Mm02_00326202 predicted 1009
8 SASI_Mm01_00023273 predicted 240
9 SASI_Mm01_00023275 predicted 1173
10 SASI_Mm01_00023276 predicted 745
11 SASI_Mm01_00023272 predicted 506
12 SASI_Mm01_00023274 predicted 1063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017818
VALIDATED
WRAP73 MISSION shRNA Bacterial Glycerol Stock
WD repeat containing, antisense to TP73
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-870s1c1
Sequence:CCGGGCCATTAATGATCCCAAGATACTCGAGTATCTTGGGATCATTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-1343s1c1
Sequence:CCGGGCATTTAAGCGGAGACTCGATCTCGAGATCGAGTCTCCGCTTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-101s1c1
Sequence:CCGGCTCCAGCTTACTCTGCAAGTTCTCGAGAACTTGCAGAGTAAGCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-982s1c1
Sequence:CCGGGCTCAGAGAGTAAATATGAGACTCGAGTCTCATATTTACTCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-542s1c1
Sequence:CCGGCAAAGATTACGTGAGCATCTTCTCGAGAAGATGCTCACGTAATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017818.3-1145s21c1
Sequence:CCGGCGACAAGGAACGACAACATTCCTCGAGGAATGTTGTCGTTCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017818.3-1510s21c1
Sequence:CCGGTGCAGAAACAGGGCTACTCTGCTCGAGCAGAGTAGCCCTGTTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017818.3-1016s21c1
Sequence:CCGGGCTCAGAGAGTAAATATGAGACTCGAGTCTCATATTTACTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017818.3-904s21c1
Sequence:CCGGGCCATTAATGATCCCAAGATACTCGAGTATCTTGGGATCATTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017818.3-135s21c1
Sequence:CCGGCTCCAGCTTACTCTGCAAGTTCTCGAGAACTTGCAGAGTAAGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017818
VALIDATED
WRAP73 MISSION shRNA shRNA Plasmid DNA
WD repeat containing, antisense to TP73
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-870s1c1
Sequence:CCGGGCCATTAATGATCCCAAGATACTCGAGTATCTTGGGATCATTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-1343s1c1
Sequence:CCGGGCATTTAAGCGGAGACTCGATCTCGAGATCGAGTCTCCGCTTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-101s1c1
Sequence:CCGGCTCCAGCTTACTCTGCAAGTTCTCGAGAACTTGCAGAGTAAGCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-982s1c1
Sequence:CCGGGCTCAGAGAGTAAATATGAGACTCGAGTCTCATATTTACTCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-542s1c1
Sequence:CCGGCAAAGATTACGTGAGCATCTTCTCGAGAAGATGCTCACGTAATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017818.3-1145s21c1
Sequence:CCGGCGACAAGGAACGACAACATTCCTCGAGGAATGTTGTCGTTCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017818.3-1510s21c1
Sequence:CCGGTGCAGAAACAGGGCTACTCTGCTCGAGCAGAGTAGCCCTGTTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017818.3-1016s21c1
Sequence:CCGGGCTCAGAGAGTAAATATGAGACTCGAGTCTCATATTTACTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017818.3-904s21c1
Sequence:CCGGGCCATTAATGATCCCAAGATACTCGAGTATCTTGGGATCATTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017818.3-135s21c1
Sequence:CCGGCTCCAGCTTACTCTGCAAGTTCTCGAGAACTTGCAGAGTAAGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017818
VALIDATED
WRAP73 MISSION shRNA Lentiviral Transduction Particles
WD repeat containing, antisense to TP73
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-870s1c1
Sequence:CCGGGCCATTAATGATCCCAAGATACTCGAGTATCTTGGGATCATTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-1343s1c1
Sequence:CCGGGCATTTAAGCGGAGACTCGATCTCGAGATCGAGTCTCCGCTTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-101s1c1
Sequence:CCGGCTCCAGCTTACTCTGCAAGTTCTCGAGAACTTGCAGAGTAAGCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-982s1c1
Sequence:CCGGGCTCAGAGAGTAAATATGAGACTCGAGTCTCATATTTACTCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017818.2-542s1c1
Sequence:CCGGCAAAGATTACGTGAGCATCTTCTCGAGAAGATGCTCACGTAATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017818.3-1145s21c1
Sequence:CCGGCGACAAGGAACGACAACATTCCTCGAGGAATGTTGTCGTTCCTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017818.3-1510s21c1
Sequence:CCGGTGCAGAAACAGGGCTACTCTGCTCGAGCAGAGTAGCCCTGTTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017818.3-1016s21c1
Sequence:CCGGGCTCAGAGAGTAAATATGAGACTCGAGTCTCATATTTACTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017818.3-904s21c1
Sequence:CCGGGCCATTAATGATCCCAAGATACTCGAGTATCTTGGGATCATTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017818.3-135s21c1
Sequence:CCGGCTCCAGCTTACTCTGCAAGTTCTCGAGAACTTGCAGAGTAAGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021499
VALIDATED
WRAP73 MISSION shRNA Bacterial Glycerol Stock
WD repeat containing, antisense to TP73
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021499.1-1119s1c1
Sequence:CCGGGTCTGGATCTGGGACATTCAACTCGAGTTGAATGTCCCAGATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021499.1-371s1c1
Sequence:CCGGCCTGAACACAACCGAATTTCACTCGAGTGAAATTCGGTTGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021499.1-1085s1c1
Sequence:CCGGCCTGGCATCAAGAAATGACAACTCGAGTTGTCATTTCTTGATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021499.1-167s1c1
Sequence:CCGGCCTTCAGATCCTTCAGTTGTACTCGAGTACAACTGAAGGATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021499.1-770s1c1
Sequence:CCGGCATTGGGAGCTACGATGGAAACTCGAGTTTCCATCGTAGCTCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021499.1-815s1c1
Sequence:CCGGCTGGAAGATGATAACTGAGTTCTCGAGAACTCAGTTATCATCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021499.1-1149s1c1
Sequence:CCGGCTGTTTGTGGTACTAGAGCATCTCGAGATGCTCTAGTACCACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021499.2-146s21c1
Sequence:CCGGTCCTGTGTCCAGTACCGATTACTCGAGTAATCGGTACTGGACACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021499.2-447s21c1
Sequence:CCGGCTGTATCTTACATCAAGTATCCTCGAGGATACTTGATGTAAGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021499.2-718s21c1
Sequence:CCGGAGCATACTGTGCCTATGAATGCTCGAGCATTCATAGGCACAGTATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021499
VALIDATED
WRAP73 MISSION shRNA shRNA Plasmid DNA
WD repeat containing, antisense to TP73
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021499.1-1119s1c1
Sequence:CCGGGTCTGGATCTGGGACATTCAACTCGAGTTGAATGTCCCAGATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021499.1-371s1c1
Sequence:CCGGCCTGAACACAACCGAATTTCACTCGAGTGAAATTCGGTTGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021499.1-1085s1c1
Sequence:CCGGCCTGGCATCAAGAAATGACAACTCGAGTTGTCATTTCTTGATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021499.1-167s1c1
Sequence:CCGGCCTTCAGATCCTTCAGTTGTACTCGAGTACAACTGAAGGATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021499.1-770s1c1
Sequence:CCGGCATTGGGAGCTACGATGGAAACTCGAGTTTCCATCGTAGCTCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021499.1-815s1c1
Sequence:CCGGCTGGAAGATGATAACTGAGTTCTCGAGAACTCAGTTATCATCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021499.1-1149s1c1
Sequence:CCGGCTGTTTGTGGTACTAGAGCATCTCGAGATGCTCTAGTACCACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021499.2-146s21c1
Sequence:CCGGTCCTGTGTCCAGTACCGATTACTCGAGTAATCGGTACTGGACACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021499.2-447s21c1
Sequence:CCGGCTGTATCTTACATCAAGTATCCTCGAGGATACTTGATGTAAGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021499.2-718s21c1
Sequence:CCGGAGCATACTGTGCCTATGAATGCTCGAGCATTCATAGGCACAGTATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021499
VALIDATED
WRAP73 MISSION shRNA Lentiviral Transduction Particles
WD repeat containing, antisense to TP73
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021499.1-1119s1c1
Sequence:CCGGGTCTGGATCTGGGACATTCAACTCGAGTTGAATGTCCCAGATCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021499.1-371s1c1
Sequence:CCGGCCTGAACACAACCGAATTTCACTCGAGTGAAATTCGGTTGTGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021499.1-1085s1c1
Sequence:CCGGCCTGGCATCAAGAAATGACAACTCGAGTTGTCATTTCTTGATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021499.1-167s1c1
Sequence:CCGGCCTTCAGATCCTTCAGTTGTACTCGAGTACAACTGAAGGATCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021499.1-770s1c1
Sequence:CCGGCATTGGGAGCTACGATGGAAACTCGAGTTTCCATCGTAGCTCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021499.1-815s1c1
Sequence:CCGGCTGGAAGATGATAACTGAGTTCTCGAGAACTCAGTTATCATCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021499.1-1149s1c1
Sequence:CCGGCTGTTTGTGGTACTAGAGCATCTCGAGATGCTCTAGTACCACAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021499.2-146s21c1
Sequence:CCGGTCCTGTGTCCAGTACCGATTACTCGAGTAATCGGTACTGGACACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021499.2-447s21c1
Sequence:CCGGCTGTATCTTACATCAAGTATCCTCGAGGATACTTGATGTAAGATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021499.2-718s21c1
Sequence:CCGGAGCATACTGTGCCTATGAATGCTCGAGCATTCATAGGCACAGTATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks