EMAIL THIS PAGE TO A FRIEND

WRB

tryptophan rich basic protein

Synonyms: CHD5
UniProtKB ID: O00258, A8KAP8, A8MQ44, D3DSH9, O60740
Gene ID:
Human(7485) Summary: This gene encodes a basic nuclear protein of unknown function. The gene is widely expressed in adult and fetal tissues. Since the region proposed to contain the gene(s) for congenital heart disease (CHD) in Down syndrome (DS) patients has been restricted to 21q22.2-22.3, this gene, which maps to 21q22.3, has a potential role in the pathogenesis of Down syndrome congenital heart disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Mouse(71446) tryptophan rich basic protein
Rat(288233) tryptophan rich basic protein
Zebrafish(335756) tryptophan rich basic protein
dog(608126) tryptophan rich basic protein
domestic cat(101098734) tryptophan rich basic protein
chicken(770415) tryptophan rich basic protein
cow(509739) tryptophan rich basic protein
sheep(101122827) tryptophan rich basic protein
domestic guinea pig(100725276) tryptophan rich basic protein
naked mole-rat(101713419) tryptophan rich basic protein
Domestic Rabbit(100328654) tryptophan rich basic protein
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004627 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004627 Rosetta Predictions human pricing
NM_199373 Rosetta Predictions rat pricing
NM_207301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075792 predicted 390
2 SASI_Hs01_00075793 predicted 374
3 SASI_Hs01_00075794 predicted 220
4 SASI_Hs01_00075795 predicted 391
5 SASI_Hs02_00338025 predicted 317
6 SASI_Hs01_00075796 predicted 340
7 SASI_Hs01_00075797 predicted 384
8 SASI_Hs01_00075798 predicted 374
9 SASI_Hs01_00075800 predicted 960
10 SASI_Hs02_00338026 predicted 1022
11 SASI_Hs01_00075799 predicted 918
12 SASI_Hs01_00075801 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033682 predicted 418
2 SASI_Rn02_00270180 predicted 345
3 SASI_Rn02_00270181 predicted 1002
4 SASI_Rn01_00033683 predicted 885
5 SASI_Rn01_00033684 predicted 857
6 SASI_Rn01_00033685 predicted 564
7 SASI_Rn01_00033686 predicted 365
8 SASI_Rn01_00033688 predicted 361
9 SASI_Rn01_00033689 predicted 752
10 SASI_Rn01_00033690 predicted 390
11 SASI_Rn01_00033681 predicted 616
12 SASI_Rn01_00033687 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021499 predicted 974
2 SASI_Mm01_00021500 predicted 766
3 SASI_Mm01_00021501 predicted 755
4 SASI_Mm02_00352053 predicted 396
5 SASI_Mm01_00021502 predicted 349
6 SASI_Mm02_00352054 predicted 732
7 SASI_Mm01_00021504 predicted 919
8 SASI_Mm01_00021506 predicted 551
9 SASI_Mm01_00021507 predicted 253
10 SASI_Mm01_00021508 predicted 960
11 SASI_Mm01_00021503 predicted 1011
12 SASI_Mm01_00021505 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004627
VALIDATED
WRB MISSION shRNA Bacterial Glycerol Stock
tryptophan rich basic protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004627.4-555s21c1
Sequence:CCGGGTTGGAATTACCTGTTGGATTCTCGAGAATCCAACAGGTAATTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004627.4-161s21c1
Sequence:CCGGCAATGTTCTTAGGATCCTCCTCTCGAGAGGAGGATCCTAAGAACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004627.4-150s21c1
Sequence:CCGGGTGTTTGGATGCAATGTTCTTCTCGAGAAGAACATTGCATCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004627.4-900s21c1
Sequence:CCGGCCATGCTGTCACTTGTGATTTCTCGAGAAATCACAAGTGACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004627.2-381s1c1
Sequence:CCGGGCCCTGATGATCTCACTCATTCTCGAGAATGAGTGAGATCATCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004627.2-104s1c1
Sequence:CCGGCAATGTTCTTAGGATCCTCCTCTCGAGAGGAGGATCCTAAGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004627.2-498s1c1
Sequence:CCGGGTTGGAATTACCTGTTGGATTCTCGAGAATCCAACAGGTAATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004627.2-93s1c1
Sequence:CCGGGTGTTTGGATGCAATGTTCTTCTCGAGAAGAACATTGCATCCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004627.2-843s1c1
Sequence:CCGGCCATGCTGTCACTTGTGATTTCTCGAGAAATCACAAGTGACAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004627
VALIDATED
WRB MISSION shRNA shRNA Plasmid DNA
tryptophan rich basic protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004627.4-555s21c1
Sequence:CCGGGTTGGAATTACCTGTTGGATTCTCGAGAATCCAACAGGTAATTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004627.4-161s21c1
Sequence:CCGGCAATGTTCTTAGGATCCTCCTCTCGAGAGGAGGATCCTAAGAACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004627.4-150s21c1
Sequence:CCGGGTGTTTGGATGCAATGTTCTTCTCGAGAAGAACATTGCATCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004627.4-900s21c1
Sequence:CCGGCCATGCTGTCACTTGTGATTTCTCGAGAAATCACAAGTGACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004627.2-381s1c1
Sequence:CCGGGCCCTGATGATCTCACTCATTCTCGAGAATGAGTGAGATCATCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004627.2-104s1c1
Sequence:CCGGCAATGTTCTTAGGATCCTCCTCTCGAGAGGAGGATCCTAAGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004627.2-498s1c1
Sequence:CCGGGTTGGAATTACCTGTTGGATTCTCGAGAATCCAACAGGTAATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004627.2-93s1c1
Sequence:CCGGGTGTTTGGATGCAATGTTCTTCTCGAGAAGAACATTGCATCCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004627.2-843s1c1
Sequence:CCGGCCATGCTGTCACTTGTGATTTCTCGAGAAATCACAAGTGACAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004627
VALIDATED
WRB MISSION shRNA Lentiviral Transduction Particles
tryptophan rich basic protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004627.4-555s21c1
Sequence:CCGGGTTGGAATTACCTGTTGGATTCTCGAGAATCCAACAGGTAATTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004627.4-161s21c1
Sequence:CCGGCAATGTTCTTAGGATCCTCCTCTCGAGAGGAGGATCCTAAGAACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004627.4-150s21c1
Sequence:CCGGGTGTTTGGATGCAATGTTCTTCTCGAGAAGAACATTGCATCCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004627.4-900s21c1
Sequence:CCGGCCATGCTGTCACTTGTGATTTCTCGAGAAATCACAAGTGACAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004627.2-381s1c1
Sequence:CCGGGCCCTGATGATCTCACTCATTCTCGAGAATGAGTGAGATCATCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004627.2-104s1c1
Sequence:CCGGCAATGTTCTTAGGATCCTCCTCTCGAGAGGAGGATCCTAAGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004627.2-498s1c1
Sequence:CCGGGTTGGAATTACCTGTTGGATTCTCGAGAATCCAACAGGTAATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004627.2-93s1c1
Sequence:CCGGGTGTTTGGATGCAATGTTCTTCTCGAGAAGAACATTGCATCCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004627.2-843s1c1
Sequence:CCGGCCATGCTGTCACTTGTGATTTCTCGAGAAATCACAAGTGACAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207301
WRB MISSION shRNA Bacterial Glycerol Stock
tryptophan rich basic protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-374s1c1
Sequence:CCGGGTTGCTTTCTACATACTACAACTCGAGTTGTAGTATGTAGAAAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-371s1c1
Sequence:CCGGAGTGTTGCTTTCTACATACTACTCGAGTAGTATGTAGAAAGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-244s1c1
Sequence:CCGGCGTCAACATGATGGACGAGTTCTCGAGAACTCGTCCATCATGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-398s1c1
Sequence:CCGGGCGCTGATGATCTCGCTCATTCTCGAGAATGAGCGAGATCATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207301.1-776s1c1
Sequence:CCGGCGTCTGATGTAGGTCTGGATTCTCGAGAATCCAGACCTACATCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207301
WRB MISSION shRNA shRNA Plasmid DNA
tryptophan rich basic protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-374s1c1
Sequence:CCGGGTTGCTTTCTACATACTACAACTCGAGTTGTAGTATGTAGAAAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-371s1c1
Sequence:CCGGAGTGTTGCTTTCTACATACTACTCGAGTAGTATGTAGAAAGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-244s1c1
Sequence:CCGGCGTCAACATGATGGACGAGTTCTCGAGAACTCGTCCATCATGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-398s1c1
Sequence:CCGGGCGCTGATGATCTCGCTCATTCTCGAGAATGAGCGAGATCATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207301.1-776s1c1
Sequence:CCGGCGTCTGATGTAGGTCTGGATTCTCGAGAATCCAGACCTACATCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207301
WRB MISSION shRNA Lentiviral Transduction Particles
tryptophan rich basic protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-374s1c1
Sequence:CCGGGTTGCTTTCTACATACTACAACTCGAGTTGTAGTATGTAGAAAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-371s1c1
Sequence:CCGGAGTGTTGCTTTCTACATACTACTCGAGTAGTATGTAGAAAGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-244s1c1
Sequence:CCGGCGTCAACATGATGGACGAGTTCTCGAGAACTCGTCCATCATGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207301.1-398s1c1
Sequence:CCGGGCGCTGATGATCTCGCTCATTCTCGAGAATGAGCGAGATCATCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207301.1-776s1c1
Sequence:CCGGCGTCTGATGTAGGTCTGGATTCTCGAGAATCCAGACCTACATCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks