EMAIL THIS PAGE TO A FRIEND

WRBP1

tryptophan rich basic protein pseudogene 1

Species: Human WRBP1(256085)
Gene ID:
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_172389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_172389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_172389 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_172389 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_172389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254572 predicted 80
2 SASI_Hs01_00254573 predicted 284
3 SASI_Hs01_00254574 predicted 299
4 SASI_Hs01_00254575 predicted 167
5 SASI_Hs01_00254576 predicted 275
6 SASI_Hs01_00254577 predicted 170
7 SASI_Hs01_00254578 predicted 300
8 SASI_Hs01_00254579 predicted 172
9 SASI_Hs01_00254580 predicted 277
10 SASI_Hs01_00254581 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_172389
WRBP1 MISSION shRNA Bacterial Glycerol Stock
tryptophan rich basic protein pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-144s1c1
Sequence:CCGGCAAAGCAGAGATCCAGGATATCTCGAGATATCCTGGATCTCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-157s1c1
Sequence:CCGGCAGGATATGAAGCAAGAGTTACTCGAGTAACTCTTGCTTCATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-174s1c1
Sequence:CCGGGTTATCCGCGGTCAATATGATCTCGAGATCATATTGACCGCGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-182s1c2
Sequence:CCGGCGGTCAATATGATGGACAAGTCTCGAGACTTGTCCATCATATTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-180s1c1
Sequence:CCGGCGCGGTCAATATGATGGACAACTCGAGTTGTCCATCATATTGACCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_172389
WRBP1 MISSION shRNA shRNA Plasmid DNA
tryptophan rich basic protein pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-144s1c1
Sequence:CCGGCAAAGCAGAGATCCAGGATATCTCGAGATATCCTGGATCTCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-157s1c1
Sequence:CCGGCAGGATATGAAGCAAGAGTTACTCGAGTAACTCTTGCTTCATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-174s1c1
Sequence:CCGGGTTATCCGCGGTCAATATGATCTCGAGATCATATTGACCGCGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-182s1c2
Sequence:CCGGCGGTCAATATGATGGACAAGTCTCGAGACTTGTCCATCATATTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-180s1c1
Sequence:CCGGCGCGGTCAATATGATGGACAACTCGAGTTGTCCATCATATTGACCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_172389
WRBP1 MISSION shRNA Lentiviral Transduction Particles
tryptophan rich basic protein pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-144s1c1
Sequence:CCGGCAAAGCAGAGATCCAGGATATCTCGAGATATCCTGGATCTCTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-157s1c1
Sequence:CCGGCAGGATATGAAGCAAGAGTTACTCGAGTAACTCTTGCTTCATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-174s1c1
Sequence:CCGGGTTATCCGCGGTCAATATGATCTCGAGATCATATTGACCGCGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-182s1c2
Sequence:CCGGCGGTCAATATGATGGACAAGTCTCGAGACTTGTCCATCATATTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_172389.1-180s1c1
Sequence:CCGGCGCGGTCAATATGATGGACAACTCGAGTTGTCCATCATATTGACCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks