EMAIL THIS PAGE TO A FRIEND

WRN

Werner syndrome, RecQ helicase-like

Synonyms: RECQ3 RECQL2 RECQL3
UniProtKB ID: Q14191, A1KYY9
Gene ID:
Human(7486) Summary: This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
Mouse(22427) Werner syndrome homolog (human)
Rat(290806) Werner syndrome
cow(505061) Werner syndrome, RecQ helicase-like
sheep(101106742) Werner syndrome, RecQ helicase-like
Domestic Rabbit(100341925) Werner syndrome, RecQ helicase-like
naked mole-rat(101724469) Werner syndrome, RecQ helicase-like
domestic guinea pig(100719896) Werner syndrome, RecQ helicase-like
Zebrafish(569495) Werner syndrome
chicken(422505) Werner syndrome
domestic cat(101095574) Werner syndrome, RecQ helicase-like
dog(493997) Werner syndrome, RecQ helicase-like
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000553 Rosetta Predictions human pricing
XM_214361 Rosetta Predictions rat pricing
NM_001122822 Rosetta Predictions mouse pricing
NM_011721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219502 predicted 3716
2 SASI_Hs02_00302794 predicted 4041
3 SASI_Hs01_00219505 predicted 1360
4 SASI_Hs02_00302795 predicted 3110
5 SASI_Hs02_00302796 predicted 4061
6 SASI_Hs01_00219508 predicted 3511
7 SASI_Hs01_00219509 predicted 3234
8 SASI_Hs01_00219511 predicted 1071
9 SASI_Hs02_00302797 predicted 3494
10 SASI_Hs02_00302798 predicted 2026
11 SASI_Hs01_00219503 predicted 5090
12 SASI_Hs01_00219504 predicted 4255
13 SASI_Hs01_00219506 predicted 1217
14 SASI_Hs01_00219507 predicted 4826
15 SASI_Hs01_00219510 predicted 2996
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141246 predicted 1013
2 SASI_Rn01_00141247 predicted 839
3 SASI_Rn01_00141248 predicted 861
4 SASI_Rn01_00141249 predicted 846
5 SASI_Rn01_00141250 predicted 882
6 SASI_Rn01_00141251 predicted 867
7 SASI_Rn01_00141252 predicted 982
8 SASI_Rn01_00141253 predicted 967
9 SASI_Rn01_00141254 predicted 856
10 SASI_Rn01_00141255 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309449 predicted 1760
2 SASI_Mm02_00309450 predicted 612
3 SASI_Mm02_00309451 predicted 330
4 SASI_Mm02_00309452 predicted 2492
5 SASI_Mm02_00309453 predicted 2086
6 SASI_Mm02_00309454 predicted 729
7 SASI_Mm02_00309455 predicted 3804
8 SASI_Mm02_00309456 predicted 3288
9 SASI_Mm02_00309457 predicted 1824
10 SASI_Mm02_00309458 predicted 2926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160015 predicted 1868
2 SASI_Mm01_00160016 predicted 718
3 SASI_Mm01_00160017 predicted 440
4 SASI_Mm01_00160018 predicted 2603
5 SASI_Mm01_00160019 predicted 2199
6 SASI_Mm01_00160020 predicted 840
7 SASI_Mm01_00160022 predicted 3915
8 SASI_Mm01_00160023 predicted 3400
9 SASI_Mm01_00160021 predicted 1934
10 SASI_Mm01_00160024 predicted 3038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000553
VALIDATED
WRN MISSION shRNA Bacterial Glycerol Stock
Werner syndrome, RecQ helicase-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000553.4-5552s21c1
Sequence:CCGGTACGTTGTTAAATGGTATTAGCTCGAGCTAATACCATTTAACAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1625s21c1
Sequence:CCGGGAGGGTTTCTATCTTACTAAACTCGAGTTTAGTAAGATAGAAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1035s21c1
Sequence:CCGGATGGAGTGGCCACCATTATACCTCGAGGTATAATGGTGGCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-3762s21c1
Sequence:CCGGCAGCGTCTTGCCGATCAATATCTCGAGATATTGATCGGCAAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-989s21c1
Sequence:CCGGAGATATTAGCATGAGTCTATCCTCGAGGATAGACTCATGCTAATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1231s21c1
Sequence:CCGGTACGTGACTTTGATATCAAATCTCGAGATTTGATATCAAAGTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1525s21c1
Sequence:CCGGTACTTAGCGACATGAACAAACCTCGAGGTTTGTTCATGTCGCTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000553.2-5319s1c1
Sequence:CCGGCCTGTAAGATTGCTTTAAGAACTCGAGTTCTTAAAGCAATCTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000553.2-1047s1c1
Sequence:CCGGCCATTATACAATAGAGGGAAACTCGAGTTTCCCTCTATTGTATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_000553.2-5088s1c1
Sequence:CCGGGCTGGCAATTACCAGAACAATCTCGAGATTGTTCTGGTAATTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000553.2-2541s1c1
Sequence:CCGGCCTGTTTATGTAGGCAAGATTCTCGAGAATCTTGCCTACATAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000553.2-2934s1c1
Sequence:CCGGCGTTGCTTAAATCTGAGAAATCTCGAGATTTCTCAGATTTAAGCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000553
VALIDATED
WRN MISSION shRNA shRNA Plasmid DNA
Werner syndrome, RecQ helicase-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000553.4-5552s21c1
Sequence:CCGGTACGTTGTTAAATGGTATTAGCTCGAGCTAATACCATTTAACAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1625s21c1
Sequence:CCGGGAGGGTTTCTATCTTACTAAACTCGAGTTTAGTAAGATAGAAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1035s21c1
Sequence:CCGGATGGAGTGGCCACCATTATACCTCGAGGTATAATGGTGGCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-3762s21c1
Sequence:CCGGCAGCGTCTTGCCGATCAATATCTCGAGATATTGATCGGCAAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-989s21c1
Sequence:CCGGAGATATTAGCATGAGTCTATCCTCGAGGATAGACTCATGCTAATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1231s21c1
Sequence:CCGGTACGTGACTTTGATATCAAATCTCGAGATTTGATATCAAAGTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1525s21c1
Sequence:CCGGTACTTAGCGACATGAACAAACCTCGAGGTTTGTTCATGTCGCTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000553.2-5319s1c1
Sequence:CCGGCCTGTAAGATTGCTTTAAGAACTCGAGTTCTTAAAGCAATCTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000553.2-1047s1c1
Sequence:CCGGCCATTATACAATAGAGGGAAACTCGAGTTTCCCTCTATTGTATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_000553.2-5088s1c1
Sequence:CCGGGCTGGCAATTACCAGAACAATCTCGAGATTGTTCTGGTAATTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000553.2-2541s1c1
Sequence:CCGGCCTGTTTATGTAGGCAAGATTCTCGAGAATCTTGCCTACATAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000553.2-2934s1c1
Sequence:CCGGCGTTGCTTAAATCTGAGAAATCTCGAGATTTCTCAGATTTAAGCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000553
VALIDATED
WRN MISSION shRNA Lentiviral Transduction Particles
Werner syndrome, RecQ helicase-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000553.4-5552s21c1
Sequence:CCGGTACGTTGTTAAATGGTATTAGCTCGAGCTAATACCATTTAACAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1625s21c1
Sequence:CCGGGAGGGTTTCTATCTTACTAAACTCGAGTTTAGTAAGATAGAAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1035s21c1
Sequence:CCGGATGGAGTGGCCACCATTATACCTCGAGGTATAATGGTGGCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-3762s21c1
Sequence:CCGGCAGCGTCTTGCCGATCAATATCTCGAGATATTGATCGGCAAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-989s21c1
Sequence:CCGGAGATATTAGCATGAGTCTATCCTCGAGGATAGACTCATGCTAATATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1231s21c1
Sequence:CCGGTACGTGACTTTGATATCAAATCTCGAGATTTGATATCAAAGTCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000553.4-1525s21c1
Sequence:CCGGTACTTAGCGACATGAACAAACCTCGAGGTTTGTTCATGTCGCTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000553.2-5319s1c1
Sequence:CCGGCCTGTAAGATTGCTTTAAGAACTCGAGTTCTTAAAGCAATCTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000553.2-1047s1c1
Sequence:CCGGCCATTATACAATAGAGGGAAACTCGAGTTTCCCTCTATTGTATAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_000553.2-5088s1c1
Sequence:CCGGGCTGGCAATTACCAGAACAATCTCGAGATTGTTCTGGTAATTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000553.2-2541s1c1
Sequence:CCGGCCTGTTTATGTAGGCAAGATTCTCGAGAATCTTGCCTACATAAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000553.2-2934s1c1
Sequence:CCGGCGTTGCTTAAATCTGAGAAATCTCGAGATTTCTCAGATTTAAGCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011721
VALIDATED
WRN MISSION shRNA Bacterial Glycerol Stock
Werner syndrome, RecQ helicase-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011721.4-3595s21c1
Sequence:CCGGGCAAGGCAGAAACACGCTAATCTCGAGATTAGCGTGTTTCTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011721.4-4074s21c1
Sequence:CCGGCCCTCCCATCAACTCAGATATCTCGAGATATCTGAGTTGATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011721.4-3885s21c1
Sequence:CCGGGGCCGTCACATACACTCTATTCTCGAGAATAGAGTGTATGTGACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011721.4-4533s21c1
Sequence:CCGGTCGAGCCATAGAGTCTTTAATCTCGAGATTAAAGACTCTATGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011721.4-3041s21c1
Sequence:CCGGGAATTGGGATTCCGATCTTATCTCGAGATAAGATCGGAATCCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011721.2-2314s1c1
Sequence:CCGGCGGCCAAATCTGTACTTAGAACTCGAGTTCTAAGTACAGATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011721.2-4089s1c1
Sequence:CCGGCCCTCCCATCAACTCAGATATCTCGAGATATCTGAGTTGATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011721.2-3068s1c1
Sequence:CCGGCGATCTTATTTCTCCGAGGATCTCGAGATCCTCGGAGAAATAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011721.2-2851s1c1
Sequence:CCGGCGACGAATCATCTTGTCCCATCTCGAGATGGGACAAGATGATTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011721.2-3610s1c1
Sequence:CCGGGCAAGGCAGAAACACGCTAATCTCGAGATTAGCGTGTTTCTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011721
VALIDATED
WRN MISSION shRNA shRNA Plasmid DNA
Werner syndrome, RecQ helicase-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011721.4-3595s21c1
Sequence:CCGGGCAAGGCAGAAACACGCTAATCTCGAGATTAGCGTGTTTCTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011721.4-4074s21c1
Sequence:CCGGCCCTCCCATCAACTCAGATATCTCGAGATATCTGAGTTGATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011721.4-3885s21c1
Sequence:CCGGGGCCGTCACATACACTCTATTCTCGAGAATAGAGTGTATGTGACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011721.4-4533s21c1
Sequence:CCGGTCGAGCCATAGAGTCTTTAATCTCGAGATTAAAGACTCTATGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011721.4-3041s21c1
Sequence:CCGGGAATTGGGATTCCGATCTTATCTCGAGATAAGATCGGAATCCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011721.2-2314s1c1
Sequence:CCGGCGGCCAAATCTGTACTTAGAACTCGAGTTCTAAGTACAGATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011721.2-4089s1c1
Sequence:CCGGCCCTCCCATCAACTCAGATATCTCGAGATATCTGAGTTGATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011721.2-3068s1c1
Sequence:CCGGCGATCTTATTTCTCCGAGGATCTCGAGATCCTCGGAGAAATAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011721.2-2851s1c1
Sequence:CCGGCGACGAATCATCTTGTCCCATCTCGAGATGGGACAAGATGATTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011721.2-3610s1c1
Sequence:CCGGGCAAGGCAGAAACACGCTAATCTCGAGATTAGCGTGTTTCTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011721
VALIDATED
WRN MISSION shRNA Lentiviral Transduction Particles
Werner syndrome, RecQ helicase-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011721.4-3595s21c1
Sequence:CCGGGCAAGGCAGAAACACGCTAATCTCGAGATTAGCGTGTTTCTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011721.4-4074s21c1
Sequence:CCGGCCCTCCCATCAACTCAGATATCTCGAGATATCTGAGTTGATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011721.4-3885s21c1
Sequence:CCGGGGCCGTCACATACACTCTATTCTCGAGAATAGAGTGTATGTGACGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011721.4-4533s21c1
Sequence:CCGGTCGAGCCATAGAGTCTTTAATCTCGAGATTAAAGACTCTATGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011721.4-3041s21c1
Sequence:CCGGGAATTGGGATTCCGATCTTATCTCGAGATAAGATCGGAATCCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011721.2-2314s1c1
Sequence:CCGGCGGCCAAATCTGTACTTAGAACTCGAGTTCTAAGTACAGATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011721.2-4089s1c1
Sequence:CCGGCCCTCCCATCAACTCAGATATCTCGAGATATCTGAGTTGATGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011721.2-3068s1c1
Sequence:CCGGCGATCTTATTTCTCCGAGGATCTCGAGATCCTCGGAGAAATAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011721.2-2851s1c1
Sequence:CCGGCGACGAATCATCTTGTCCCATCTCGAGATGGGACAAGATGATTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011721.2-3610s1c1
Sequence:CCGGGCAAGGCAGAAACACGCTAATCTCGAGATTAGCGTGTTTCTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks