EMAIL THIS PAGE TO A FRIEND

WRNIP1

Werner helicase interacting protein 1

Synonyms: RP11-420G6.2 WHIP bA420G6.2
Gene ID:
Human(56897) Summary: Werner's syndrome is a rare autosomal recessive disorder characterized by accelerated aging that is caused by defects in the Werner syndrome ATP-dependent helicase gene (WRN). The protein encoded by this gene interacts with the exonuclease-containing N-terminal portion of the Werner protein. This protein has a ubiquitin-binding zinc-finger domain in the N-terminus, an ATPase domain, and two leucine zipper motifs in the C-terminus. It has sequence similarity to replication factor C family proteins and is conserved from E. coli to human. This protein likely accumulates at sites of DNA damage by interacting with polyubiquinated proteins and also binds to DNA polymerase delta and increases the initiation frequency of DNA polymerase delta-mediated DNA synthesis. This protein also interacts with nucleoporins at nuclear pore complexes. Two transcript variants encoding different isoforms have been isolated for this gene. [provided by RefSeq, Jul 2012]
Mouse(78903) Werner helicase interacting protein 1
Rat(282835) Werner helicase interacting protein 1
Zebrafish(405856) Werner helicase interacting protein 1
domestic cat(101087922) Werner helicase interacting protein 1
dog(478698) Werner helicase interacting protein 1
chicken(395089) Werner helicase interacting protein 1
domestic guinea pig(100720377) Werner helicase interacting protein 1
naked mole-rat(101701117) Werner helicase interacting protein 1
cow(782711) WRNIP1 protein-like
cow(788824) Werner helicase interacting protein 1
sheep(101123507) Werner helicase interacting protein 1
Gene Class: ATPase
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020135 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133741 MISSION® esiRNA esiRNA human WRNIP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020135 Rosetta Predictions human pricing
NM_130395 Rosetta Predictions human pricing
NM_172332 Rosetta Predictions rat pricing
NM_030215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169893 predicted 2057
2 SASI_Hs01_00169894 predicted 1584
3 SASI_Hs01_00169895 predicted 2349
4 SASI_Hs01_00169896 predicted 1584
5 SASI_Hs01_00169897 predicted 1560
6 SASI_Hs01_00169898 predicted 1541
7 SASI_Hs01_00169899 predicted 1866
8 SASI_Hs01_00169900 predicted 1602
9 SASI_Hs01_00169901 predicted 1946
10 SASI_Hs01_00169902 predicted 1862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073712 predicted 1983
2 SASI_Hs01_00073713 predicted 1510
3 SASI_Hs01_00073714 predicted 2278
4 SASI_Hs01_00073715 predicted 1512
5 SASI_Hs01_00073716 predicted 1488
6 SASI_Hs01_00073717 predicted 1467
7 SASI_Hs01_00073718 predicted 1791
8 SASI_Hs01_00073719 predicted 1525
9 SASI_Hs01_00073720 predicted 1873
10 SASI_Hs01_00073721 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093429 predicted 852
2 SASI_Rn01_00093430 predicted 1344
3 SASI_Rn01_00093431 predicted 1027
4 SASI_Rn02_00269223 predicted 1058
5 SASI_Rn01_00093432 predicted 1928
6 SASI_Rn01_00093433 predicted 1071
7 SASI_Rn01_00093434 predicted 1564
8 SASI_Rn01_00093436 predicted 1939
9 SASI_Rn01_00093437 predicted 1221
10 SASI_Rn01_00093438 predicted 1614
11 SASI_Rn01_00093435 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100738 predicted 1302
2 SASI_Mm01_00100739 predicted 1357
3 SASI_Mm01_00100740 predicted 1085
4 SASI_Mm01_00100741 predicted 954
5 SASI_Mm01_00100742 predicted 1233
6 SASI_Mm01_00100744 predicted 1050
7 SASI_Mm01_00100745 predicted 1959
8 SASI_Mm01_00100746 predicted 1585
9 SASI_Mm01_00100747 predicted 1719
10 SASI_Mm02_00336642 predicted 891
11 SASI_Mm01_00100743 predicted 1561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020135
VALIDATED
WRNIP1 MISSION shRNA Bacterial Glycerol Stock
Werner helicase interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020135.x-2064s1c1
Sequence:CCGGCTGATGAAGGATTTGGGCTATCTCGAGATAGCCCAAATCCTTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-2268s1c1
Sequence:CCGGGTTGCCTGGTGGAAGTTAGAACTCGAGTTCTAACTTCCACCAGGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-1302s1c1
Sequence:CCGGCGCTGTCGAGTGATTGTTCTTCTCGAGAAGAACAATCACTCGACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-1042s1c1
Sequence:CCGGACAGCAAGAAACATAGCATAACTCGAGTTATGCTATGTTTCTTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-1974s1c1
Sequence:CCGGAGCGCCTACAACAACGTCAAACTCGAGTTTGACGTTGTTGTAGGCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1099s21c1
Sequence:CCGGATGATGTGCGAGATGTCATAACTCGAGTTATGACATCTCGCACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1579s21c1
Sequence:CCGGAGAAGAGTGGGCAATCCTATTCTCGAGAATAGGATTGCCCACTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1871s21c1
Sequence:CCGGTGCCTACCAAGGCTGTCATTTCTCGAGAAATGACAGCCTTGGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020135.2-2335s21c1
Sequence:CCGGGCGCAGTTCTTTCGAATAAATCTCGAGATTTATTCGAAAGAACTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1068s21c1
Sequence:CCGGGTGACATTATCTGCAACAAATCTCGAGATTTGTTGCAGATAATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020135
VALIDATED
WRNIP1 MISSION shRNA shRNA Plasmid DNA
Werner helicase interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020135.x-2064s1c1
Sequence:CCGGCTGATGAAGGATTTGGGCTATCTCGAGATAGCCCAAATCCTTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-2268s1c1
Sequence:CCGGGTTGCCTGGTGGAAGTTAGAACTCGAGTTCTAACTTCCACCAGGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-1302s1c1
Sequence:CCGGCGCTGTCGAGTGATTGTTCTTCTCGAGAAGAACAATCACTCGACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-1042s1c1
Sequence:CCGGACAGCAAGAAACATAGCATAACTCGAGTTATGCTATGTTTCTTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-1974s1c1
Sequence:CCGGAGCGCCTACAACAACGTCAAACTCGAGTTTGACGTTGTTGTAGGCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1099s21c1
Sequence:CCGGATGATGTGCGAGATGTCATAACTCGAGTTATGACATCTCGCACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1579s21c1
Sequence:CCGGAGAAGAGTGGGCAATCCTATTCTCGAGAATAGGATTGCCCACTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1871s21c1
Sequence:CCGGTGCCTACCAAGGCTGTCATTTCTCGAGAAATGACAGCCTTGGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020135.2-2335s21c1
Sequence:CCGGGCGCAGTTCTTTCGAATAAATCTCGAGATTTATTCGAAAGAACTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1068s21c1
Sequence:CCGGGTGACATTATCTGCAACAAATCTCGAGATTTGTTGCAGATAATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020135
VALIDATED
WRNIP1 MISSION shRNA Lentiviral Transduction Particles
Werner helicase interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020135.x-2064s1c1
Sequence:CCGGCTGATGAAGGATTTGGGCTATCTCGAGATAGCCCAAATCCTTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-2268s1c1
Sequence:CCGGGTTGCCTGGTGGAAGTTAGAACTCGAGTTCTAACTTCCACCAGGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-1302s1c1
Sequence:CCGGCGCTGTCGAGTGATTGTTCTTCTCGAGAAGAACAATCACTCGACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-1042s1c1
Sequence:CCGGACAGCAAGAAACATAGCATAACTCGAGTTATGCTATGTTTCTTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020135.x-1974s1c1
Sequence:CCGGAGCGCCTACAACAACGTCAAACTCGAGTTTGACGTTGTTGTAGGCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1099s21c1
Sequence:CCGGATGATGTGCGAGATGTCATAACTCGAGTTATGACATCTCGCACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1579s21c1
Sequence:CCGGAGAAGAGTGGGCAATCCTATTCTCGAGAATAGGATTGCCCACTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1871s21c1
Sequence:CCGGTGCCTACCAAGGCTGTCATTTCTCGAGAAATGACAGCCTTGGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020135.2-2335s21c1
Sequence:CCGGGCGCAGTTCTTTCGAATAAATCTCGAGATTTATTCGAAAGAACTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020135.2-1068s21c1
Sequence:CCGGGTGACATTATCTGCAACAAATCTCGAGATTTGTTGCAGATAATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030215
VALIDATED
WRNIP1 MISSION shRNA Bacterial Glycerol Stock
Werner helicase interacting protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030215.2-2289s1c1
Sequence:CCGGCCAGAAATTAAGGGTTCCATACTCGAGTATGGAACCCTTAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1579s1c1
Sequence:CCGGGCGGTCAAACCTATTCTCCTACTCGAGTAGGAGAATAGGTTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1946s1c1
Sequence:CCGGCCCAAAGTCCATAGAGGTGTACTCGAGTACACCTCTATGGACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1301s1c1
Sequence:CCGGCCGGGTAATTGTTCTTGAGAACTCGAGTTCTCAAGAACAATTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1051s1c1
Sequence:CCGGGCATAAGGTTTGTGACATTATCTCGAGATAATGTCACAAACCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030215.2-1916s21c1
Sequence:CCGGGGCCCAGTGTGTGGTCTATTTCTCGAGAAATAGACCACACACTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030215.2-2316s21c1
Sequence:CCGGGGTGGTTACTTCAGCTAAATGCTCGAGCATTTAGCTGAAGTAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030215.2-1330s21c1
Sequence:CCGGTAGAGGCAATGGTGACGATTTCTCGAGAAATCGTCACCATTGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030215.2-1301s21c1
Sequence:CCGGCCGGGTAATTGTTCTTGAGAACTCGAGTTCTCAAGAACAATTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030215.2-1579s21c1
Sequence:CCGGGCGGTCAAACCTATTCTCCTACTCGAGTAGGAGAATAGGTTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030215
VALIDATED
WRNIP1 MISSION shRNA shRNA Plasmid DNA
Werner helicase interacting protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030215.2-2289s1c1
Sequence:CCGGCCAGAAATTAAGGGTTCCATACTCGAGTATGGAACCCTTAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1579s1c1
Sequence:CCGGGCGGTCAAACCTATTCTCCTACTCGAGTAGGAGAATAGGTTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1946s1c1
Sequence:CCGGCCCAAAGTCCATAGAGGTGTACTCGAGTACACCTCTATGGACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1301s1c1
Sequence:CCGGCCGGGTAATTGTTCTTGAGAACTCGAGTTCTCAAGAACAATTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1051s1c1
Sequence:CCGGGCATAAGGTTTGTGACATTATCTCGAGATAATGTCACAAACCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030215.2-1916s21c1
Sequence:CCGGGGCCCAGTGTGTGGTCTATTTCTCGAGAAATAGACCACACACTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030215.2-2316s21c1
Sequence:CCGGGGTGGTTACTTCAGCTAAATGCTCGAGCATTTAGCTGAAGTAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030215.2-1330s21c1
Sequence:CCGGTAGAGGCAATGGTGACGATTTCTCGAGAAATCGTCACCATTGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030215.2-1301s21c1
Sequence:CCGGCCGGGTAATTGTTCTTGAGAACTCGAGTTCTCAAGAACAATTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030215.2-1579s21c1
Sequence:CCGGGCGGTCAAACCTATTCTCCTACTCGAGTAGGAGAATAGGTTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030215
VALIDATED
WRNIP1 MISSION shRNA Lentiviral Transduction Particles
Werner helicase interacting protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030215.2-2289s1c1
Sequence:CCGGCCAGAAATTAAGGGTTCCATACTCGAGTATGGAACCCTTAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1579s1c1
Sequence:CCGGGCGGTCAAACCTATTCTCCTACTCGAGTAGGAGAATAGGTTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1946s1c1
Sequence:CCGGCCCAAAGTCCATAGAGGTGTACTCGAGTACACCTCTATGGACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1301s1c1
Sequence:CCGGCCGGGTAATTGTTCTTGAGAACTCGAGTTCTCAAGAACAATTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030215.2-1051s1c1
Sequence:CCGGGCATAAGGTTTGTGACATTATCTCGAGATAATGTCACAAACCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030215.2-1916s21c1
Sequence:CCGGGGCCCAGTGTGTGGTCTATTTCTCGAGAAATAGACCACACACTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030215.2-2316s21c1
Sequence:CCGGGGTGGTTACTTCAGCTAAATGCTCGAGCATTTAGCTGAAGTAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030215.2-1330s21c1
Sequence:CCGGTAGAGGCAATGGTGACGATTTCTCGAGAAATCGTCACCATTGCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030215.2-1301s21c1
Sequence:CCGGCCGGGTAATTGTTCTTGAGAACTCGAGTTCTCAAGAACAATTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030215.2-1579s21c1
Sequence:CCGGGCGGTCAAACCTATTCTCCTACTCGAGTAGGAGAATAGGTTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks