EMAIL THIS PAGE TO A FRIEND

WSB1

WD repeat and SOCS box containing 1

Synonyms: SWIP1 WSB-1
UniProtKB ID: Q9Y6I7, Q9NRB1, Q9UBH9, Q9UG25, Q9UNN6
Gene ID:
Human(26118) Summary: This gene encodes a member of the WD-protein subfamily. This protein shares a high sequence identity to mouse and chick proteins. It contains several WD-repeats spanning most of the protein and an SOCS box in the C-terminus. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(78889) WD repeat and SOCS box-containing 1
Rat(303336) WD repeat and SOCS box-containing 1
Zebrafish(323226) WD repeat and SOCS box-containing 1
Horse(100058727) WD repeat and SOCS box containing 1
domestic cat(101087690) WD repeat and SOCS box containing 1
dog(480619) WD repeat and SOCS box containing 1
chicken(395685) WD repeat and SOCS box containing 1
cow(614851) WD repeat and SOCS box containing 1
naked mole-rat(101697539) WD repeat and SOCS box containing 1
domestic guinea pig(100729636) WD repeat and SOCS box containing 1
177 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015626 Rosetta Predictions human pricing
NM_134265 Rosetta Predictions human pricing
NM_001025664 Rosetta Predictions rat pricing
NM_001042561 Rosetta Predictions rat pricing
NM_001042565 Rosetta Predictions mouse pricing
NM_019653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108203 predicted 1137
2 SASI_Hs01_00108204 predicted 1419
3 SASI_Hs01_00108205 predicted 1608
4 SASI_Hs01_00108206 predicted 1590
5 SASI_Hs02_00348217 predicted 1055
6 SASI_Hs01_00108207 predicted 1641
7 SASI_Hs01_00108208 predicted 1633
8 SASI_Hs01_00108210 predicted 1329
9 SASI_Hs01_00108211 predicted 1357
10 SASI_Hs01_00108212 predicted 1386
11 SASI_Hs01_00108209 predicted 1681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025877 predicted 699
2 SASI_Hs01_00025878 predicted 983
3 SASI_Hs01_00025879 predicted 1174
4 SASI_Hs01_00025880 predicted 1158
5 SASI_Hs02_00363304 predicted 614
6 SASI_Hs01_00025881 predicted 1208
7 SASI_Hs01_00025882 predicted 1193
8 SASI_Hs01_00025884 predicted 890
9 SASI_Hs01_00025885 predicted 923
10 SASI_Hs01_00025886 predicted 944
11 SASI_Hs01_00025883 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203252 predicted 975
2 SASI_Rn02_00203253 predicted 1059
3 SASI_Rn01_00104810 predicted 728
4 SASI_Rn01_00104811 predicted 719
5 SASI_Rn01_00104812 predicted 623
6 SASI_Rn01_00104813 predicted 987
7 SASI_Rn01_00104814 predicted 841
8 SASI_Rn01_00104815 predicted 608
9 SASI_Rn02_00203254 predicted 701
10 SASI_Rn02_00203255 predicted 617
11 SASI_Rn01_00104808 predicted 993
12 SASI_Rn01_00104809 predicted 791
13 SASI_Rn01_00104816 predicted 1005
14 SASI_Rn01_00104817 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204930 predicted 1382
2 SASI_Rn02_00204931 predicted 1479
3 SASI_Rn02_00204932 predicted 1141
4 SASI_Rn02_00204933 predicted 1126
5 SASI_Rn02_00204934 predicted 1035
6 SASI_Rn02_00204935 predicted 1400
7 SASI_Rn02_00204936 predicted 1255
8 SASI_Rn02_00204937 predicted 1020
9 SASI_Rn02_00204938 predicted 1111
10 SASI_Rn02_00204939 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290625 predicted 1200
2 SASI_Mm02_00290626 predicted 1167
3 SASI_Mm02_00290627 predicted 1398
4 SASI_Mm02_00290628 predicted 1455
5 SASI_Mm02_00290629 predicted 1294
6 SASI_Mm02_00290630 predicted 1577
7 SASI_Mm02_00290631 predicted 1153
8 SASI_Mm02_00290632 predicted 1328
9 SASI_Mm02_00290633 predicted 1517
10 SASI_Mm02_00290634 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096222 predicted 1340
2 SASI_Mm02_00324693 predicted 1321
3 SASI_Mm02_00324694 predicted 1548
4 SASI_Mm02_00324695 predicted 1601
5 SASI_Mm02_00324696 predicted 1445
6 SASI_Mm02_00324697 predicted 1727
7 SASI_Mm02_00324698 predicted 1300
8 SASI_Mm02_00324699 predicted 1477
9 SASI_Mm01_00096224 predicted 1664
10 SASI_Mm02_00324700 predicted 1665
11 SASI_Mm01_00096223 predicted 950
12 SASI_Mm01_00096225 predicted 845
13 SASI_Mm01_00096226 predicted 920
14 SASI_Mm01_00096227 predicted 962
15 SASI_Mm01_00096228 predicted 1469
16 SASI_Mm01_00096229 predicted 987
17 SASI_Mm01_00096230 predicted 908
18 SASI_Mm01_00096231 predicted 1257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015626
VALIDATED
WSB1 MISSION shRNA Bacterial Glycerol Stock
WD repeat and SOCS box containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015626.8-1465s21c1
Sequence:CCGGGGTCCCTAGCCTGCAACATTTCTCGAGAAATGTTGCAGGCTAGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-1640s21c1
Sequence:CCGGAGCTTTACTGACTTCAATTATCTCGAGATAATTGAAGTCAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-805s21c1
Sequence:CCGGCCTTAACTTGGTAGATCATACCTCGAGGTATGATCTACCAAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015626.8-606s21c1
Sequence:CCGGATAAGCCTCGTGAACATATTACTCGAGTAATATGTTCACGAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-1329s21c1
Sequence:CCGGGGAGAATTGATGAGGATTATCCTCGAGGATAATCCTCATCAATTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-1560s21c1
Sequence:CCGGAGTTTCTCTCGTATCGTATTTCTCGAGAAATACGATACGAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015626.7-923s1c1
Sequence:CCGGGATGGAAACATGATGAAAGTACTCGAGTACTTTCATCATGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015626.7-1166s1c1
Sequence:CCGGGATCCACATAATGGAGACATTCTCGAGAATGTCTCCATTATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015626.7-344s1c1
Sequence:CCGGGAGAAAGAGATCGTGAGATTACTCGAGTAATCTCACGATCTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015626.7-352s1c1
Sequence:CCGGGATCGTGAGATTACGTACTATCTCGAGATAGTACGTAATCTCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015626
VALIDATED
WSB1 MISSION shRNA shRNA Plasmid DNA
WD repeat and SOCS box containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015626.8-1465s21c1
Sequence:CCGGGGTCCCTAGCCTGCAACATTTCTCGAGAAATGTTGCAGGCTAGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-1640s21c1
Sequence:CCGGAGCTTTACTGACTTCAATTATCTCGAGATAATTGAAGTCAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-805s21c1
Sequence:CCGGCCTTAACTTGGTAGATCATACCTCGAGGTATGATCTACCAAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015626.8-606s21c1
Sequence:CCGGATAAGCCTCGTGAACATATTACTCGAGTAATATGTTCACGAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-1329s21c1
Sequence:CCGGGGAGAATTGATGAGGATTATCCTCGAGGATAATCCTCATCAATTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-1560s21c1
Sequence:CCGGAGTTTCTCTCGTATCGTATTTCTCGAGAAATACGATACGAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015626.7-923s1c1
Sequence:CCGGGATGGAAACATGATGAAAGTACTCGAGTACTTTCATCATGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015626.7-1166s1c1
Sequence:CCGGGATCCACATAATGGAGACATTCTCGAGAATGTCTCCATTATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015626.7-344s1c1
Sequence:CCGGGAGAAAGAGATCGTGAGATTACTCGAGTAATCTCACGATCTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015626.7-352s1c1
Sequence:CCGGGATCGTGAGATTACGTACTATCTCGAGATAGTACGTAATCTCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015626
VALIDATED
WSB1 MISSION shRNA Lentiviral Transduction Particles
WD repeat and SOCS box containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015626.8-1465s21c1
Sequence:CCGGGGTCCCTAGCCTGCAACATTTCTCGAGAAATGTTGCAGGCTAGGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-1640s21c1
Sequence:CCGGAGCTTTACTGACTTCAATTATCTCGAGATAATTGAAGTCAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-805s21c1
Sequence:CCGGCCTTAACTTGGTAGATCATACCTCGAGGTATGATCTACCAAGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015626.8-606s21c1
Sequence:CCGGATAAGCCTCGTGAACATATTACTCGAGTAATATGTTCACGAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-1329s21c1
Sequence:CCGGGGAGAATTGATGAGGATTATCCTCGAGGATAATCCTCATCAATTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015626.8-1560s21c1
Sequence:CCGGAGTTTCTCTCGTATCGTATTTCTCGAGAAATACGATACGAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015626.7-923s1c1
Sequence:CCGGGATGGAAACATGATGAAAGTACTCGAGTACTTTCATCATGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015626.7-1166s1c1
Sequence:CCGGGATCCACATAATGGAGACATTCTCGAGAATGTCTCCATTATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015626.7-344s1c1
Sequence:CCGGGAGAAAGAGATCGTGAGATTACTCGAGTAATCTCACGATCTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015626.7-352s1c1
Sequence:CCGGGATCGTGAGATTACGTACTATCTCGAGATAGTACGTAATCTCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019653
VALIDATED
WSB1 MISSION shRNA Bacterial Glycerol Stock
WD repeat and SOCS box containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019653.3-1820s21c1
Sequence:CCGGACATGAGCTGCTGCTATATATCTCGAGATATATAGCAGCAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019653.3-340s21c1
Sequence:CCGGATCGTGAGATCACGTACTATACTCGAGTATAGTACGTGATCTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019653.3-430s21c1
Sequence:CCGGGCTCCTGATGGTTCCTACTTTCTCGAGAAAGTAGGAACCATCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019653.3-851s21c1
Sequence:CCGGGCTTACTCCTTGTATCAGCTTCTCGAGAAGCTGATACAAGGAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019653.3-1348s21c1
Sequence:CCGGGCACCTTTGAGCAATGGTCTTCTCGAGAAGACCATTGCTCAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-540s1c1
Sequence:CCGGCCTCCTTAATTTGGTAGACCACTCGAGTGGTCTACCAAATTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019653.2-2075s1c1
Sequence:CCGGGCAGAGGATATTGGTAACTTACTCGAGTAAGTTACCAATATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-181s1c1
Sequence:CCGGGCTCCTGATGGTTCCTACTTTCTCGAGAAAGTAGGAACCATCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-1099s1c1
Sequence:CCGGGCACCTTTGAGCAATGGTCTTCTCGAGAAGACCATTGCTCAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-602s1c1
Sequence:CCGGGCTTACTCCTTGTATCAGCTTCTCGAGAAGCTGATACAAGGAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019653
VALIDATED
WSB1 MISSION shRNA shRNA Plasmid DNA
WD repeat and SOCS box containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019653.3-1820s21c1
Sequence:CCGGACATGAGCTGCTGCTATATATCTCGAGATATATAGCAGCAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019653.3-340s21c1
Sequence:CCGGATCGTGAGATCACGTACTATACTCGAGTATAGTACGTGATCTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019653.3-430s21c1
Sequence:CCGGGCTCCTGATGGTTCCTACTTTCTCGAGAAAGTAGGAACCATCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019653.3-851s21c1
Sequence:CCGGGCTTACTCCTTGTATCAGCTTCTCGAGAAGCTGATACAAGGAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019653.3-1348s21c1
Sequence:CCGGGCACCTTTGAGCAATGGTCTTCTCGAGAAGACCATTGCTCAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-540s1c1
Sequence:CCGGCCTCCTTAATTTGGTAGACCACTCGAGTGGTCTACCAAATTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019653.2-2075s1c1
Sequence:CCGGGCAGAGGATATTGGTAACTTACTCGAGTAAGTTACCAATATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-181s1c1
Sequence:CCGGGCTCCTGATGGTTCCTACTTTCTCGAGAAAGTAGGAACCATCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-1099s1c1
Sequence:CCGGGCACCTTTGAGCAATGGTCTTCTCGAGAAGACCATTGCTCAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-602s1c1
Sequence:CCGGGCTTACTCCTTGTATCAGCTTCTCGAGAAGCTGATACAAGGAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019653
VALIDATED
WSB1 MISSION shRNA Lentiviral Transduction Particles
WD repeat and SOCS box containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311522    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019653.3-1820s21c1
Sequence:CCGGACATGAGCTGCTGCTATATATCTCGAGATATATAGCAGCAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019653.3-340s21c1
Sequence:CCGGATCGTGAGATCACGTACTATACTCGAGTATAGTACGTGATCTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019653.3-430s21c1
Sequence:CCGGGCTCCTGATGGTTCCTACTTTCTCGAGAAAGTAGGAACCATCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019653.3-851s21c1
Sequence:CCGGGCTTACTCCTTGTATCAGCTTCTCGAGAAGCTGATACAAGGAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019653.3-1348s21c1
Sequence:CCGGGCACCTTTGAGCAATGGTCTTCTCGAGAAGACCATTGCTCAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-540s1c1
Sequence:CCGGCCTCCTTAATTTGGTAGACCACTCGAGTGGTCTACCAAATTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019653.2-2075s1c1
Sequence:CCGGGCAGAGGATATTGGTAACTTACTCGAGTAAGTTACCAATATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-181s1c1
Sequence:CCGGGCTCCTGATGGTTCCTACTTTCTCGAGAAAGTAGGAACCATCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-1099s1c1
Sequence:CCGGGCACCTTTGAGCAATGGTCTTCTCGAGAAGACCATTGCTCAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019653.2-602s1c1
Sequence:CCGGGCTTACTCCTTGTATCAGCTTCTCGAGAAGCTGATACAAGGAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks